HUGE

Gene/Protein Characteristic Table for KIAA1622

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00257
Accession No. :	AB046842
Description :	HEAT-like repeat-containing protein isoform 1.
HUGO Gene Name :
Clone Name :	hj06359b [Vector Info]
Flexi ORF Clone :	pF1KA1622
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3786 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1091 bp

Genome contig ID gi51511730f_93610483
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GAATTTACTCAAAATAAAACATAGGTTAATGAGAT
Flanking genome sequence
(205344 - 205393)
----+----*----+----*----+----*----+----*----+----*
ACCTGTGTTTGTGAAAAAAAGTCTTAAATACTTTCCTGCAGTTTTTATTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 93710483 93815825 25 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 892 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_522937	99.8	HEAT-like repea...	Pan troglodytes
EDL18824	89.9	RIKEN cDNA 8430...	Mus musculus
Q8C0Y0	90.7	Serine/threonin...	Mus musculus
AAI11888	90.9	RIKEN cDNA 8430...	Mus musculus
XP_547959	95.9	similar to HEAT...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 226 262 PF02985 HEAT

IPR000357 265 301 PF02985 HEAT

IPR000357 411 446 PF02985 HEAT

ProfileScan IPR000357 232 269 PS50077 HEAT

IPR000357 271 309 PS50077 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	226	262	PF02985	HEAT
IPR000357	265	301	PF02985	HEAT
IPR000357	411	446	PF02985	HEAT
ProfileScan	IPR000357	232	269	PS50077	HEAT
IPR000357	271	309	PS50077	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAATTTTCACTCCAGATCAGC

Primer_r
: CATGGCCGGAAAGTTATAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1091 bp
Genome contig ID	gi51511730f_93610483
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GAATTTACTCAAAATAAAACATAGGTTAATGAGAT
Flanking genome sequence (205344 - 205393)	----+--------+--------+--------+--------+----* ACCTGTGTTTGTGAAAAAAAGTCTTAAATACTTTCCTGCAGTTTTTATTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	93710483	93815825	25	99.7	Perfect prediction

Primer_f	: GAATTTTCACTCCAGATCAGC
Primer_r	: CATGGCCGGAAAGTTATAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1622

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information