HUGE

Gene/Protein Characteristic Table for KIAA1615

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07490
Accession No. :	AB046835
Description :	Zinc finger protein 529.
HUGO Gene Name :	zinc finger protein 529 (ZNF529)
Clone Name :	fj13419 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3934 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2478 bp

Genome contig ID gi42406306r_41627134
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CCTTGTATACAGACATTAAAATTAGTGAGAGAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATATCCTTGTGTCTTGGCTTTTACTTTTTGAAGTCATTAACAAATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 41727134 41731063 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_066002	1.1e-212	99.8	zinc finger pro...	Homo sapiens
Q6P280	1.5e-212	99.8	Zinc finger pro...	Homo sapiens
XP_512621	1e-209	98.8	zinc finger pro...	Pan troglodytes
BAB15068	7.5e-202	99.8	unnamed protein...	Homo sapiens
XP_587640	1.3e-160	78.6	similar to Zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037852	1.8e-65	46.3	KIAA1431
AB046779	6e-65	53.3	KIAA1559
AB037817	3.8e-62	46.6	KIAA1396
AB037770	1e-61	48.9	KIAA1349
AB107355	2.4e-61	48.2	KIAA2033

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 203 226 PD000003 Zinc finger

IPR007087 231 254 PD000003 Zinc finger

IPR007087 259 282 PD000003 Zinc finger

IPR007087 287 310 PD000003 Zinc finger

IPR007087 315 338 PD000003 Zinc finger

IPR007087 343 366 PD000003 Zinc finger

IPR007087 371 394 PD000003 Zinc finger

IPR007087 399 422 PD000003 Zinc finger

IPR007087 427 450 PD000003 Zinc finger

HMMPfam IPR007087 203 225 PF00096 Zinc finger

IPR007087 231 253 PF00096 Zinc finger

IPR007087 259 281 PF00096 Zinc finger

IPR007087 287 309 PF00096 Zinc finger

IPR007087 315 337 PF00096 Zinc finger

IPR007087 343 365 PF00096 Zinc finger

IPR007087 371 393 PF00096 Zinc finger

IPR007087 399 421 PF00096 Zinc finger

IPR007087 427 449 PF00096 Zinc finger

HMMSmart IPR015880 203 225 SM00355 Zinc finger

IPR015880 231 253 SM00355 Zinc finger

IPR015880 259 281 SM00355 Zinc finger

IPR015880 287 309 SM00355 Zinc finger

IPR015880 315 337 SM00355 Zinc finger

IPR015880 343 365 SM00355 Zinc finger

IPR015880 371 393 SM00355 Zinc finger

IPR015880 399 421 SM00355 Zinc finger

IPR015880 427 449 SM00355 Zinc finger

ProfileScan IPR007087 120 147 PS50157 Zinc finger

IPR007087 203 230 PS50157 Zinc finger

IPR007087 231 258 PS50157 Zinc finger

IPR007087 259 286 PS50157 Zinc finger

IPR007087 287 314 PS50157 Zinc finger

IPR007087 315 342 PS50157 Zinc finger

IPR007087 343 370 PS50157 Zinc finger

IPR007087 371 398 PS50157 Zinc finger

IPR007087 399 426 PS50157 Zinc finger

IPR007087 427 454 PS50157 Zinc finger

IPR007087 455 482 PS50157 Zinc finger

ScanRegExp IPR007087 205 225 PS00028 Zinc finger

IPR007087 233 253 PS00028 Zinc finger

IPR007087 261 281 PS00028 Zinc finger

IPR007087 289 309 PS00028 Zinc finger

IPR007087 317 337 PS00028 Zinc finger

IPR007087 345 365 PS00028 Zinc finger

IPR007087 373 393 PS00028 Zinc finger

IPR007087 401 421 PS00028 Zinc finger

IPR007087 429 449 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	203	226	PD000003	Zinc finger
IPR007087	231	254	PD000003	Zinc finger
IPR007087	259	282	PD000003	Zinc finger
IPR007087	287	310	PD000003	Zinc finger
IPR007087	315	338	PD000003	Zinc finger
IPR007087	343	366	PD000003	Zinc finger
IPR007087	371	394	PD000003	Zinc finger
IPR007087	399	422	PD000003	Zinc finger
IPR007087	427	450	PD000003	Zinc finger
HMMPfam	IPR007087	203	225	PF00096	Zinc finger
IPR007087	231	253	PF00096	Zinc finger
IPR007087	259	281	PF00096	Zinc finger
IPR007087	287	309	PF00096	Zinc finger
IPR007087	315	337	PF00096	Zinc finger
IPR007087	343	365	PF00096	Zinc finger
IPR007087	371	393	PF00096	Zinc finger
IPR007087	399	421	PF00096	Zinc finger
IPR007087	427	449	PF00096	Zinc finger
HMMSmart	IPR015880	203	225	SM00355	Zinc finger
IPR015880	231	253	SM00355	Zinc finger
IPR015880	259	281	SM00355	Zinc finger
IPR015880	287	309	SM00355	Zinc finger
IPR015880	315	337	SM00355	Zinc finger
IPR015880	343	365	SM00355	Zinc finger
IPR015880	371	393	SM00355	Zinc finger
IPR015880	399	421	SM00355	Zinc finger
IPR015880	427	449	SM00355	Zinc finger
ProfileScan	IPR007087	120	147	PS50157	Zinc finger
IPR007087	203	230	PS50157	Zinc finger
IPR007087	231	258	PS50157	Zinc finger
IPR007087	259	286	PS50157	Zinc finger
IPR007087	287	314	PS50157	Zinc finger
IPR007087	315	342	PS50157	Zinc finger
IPR007087	343	370	PS50157	Zinc finger
IPR007087	371	398	PS50157	Zinc finger
IPR007087	399	426	PS50157	Zinc finger
IPR007087	427	454	PS50157	Zinc finger
IPR007087	455	482	PS50157	Zinc finger
ScanRegExp	IPR007087	205	225	PS00028	Zinc finger
IPR007087	233	253	PS00028	Zinc finger
IPR007087	261	281	PS00028	Zinc finger
IPR007087	289	309	PS00028	Zinc finger
IPR007087	317	337	PS00028	Zinc finger
IPR007087	345	365	PS00028	Zinc finger
IPR007087	373	393	PS00028	Zinc finger
IPR007087	401	421	PS00028	Zinc finger
IPR007087	429	449	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCCAACCGAAAATTTACACTG

Primer_r
: AACAGACTTTAAGAGAGGGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: CCR
Primer_f	: GCCAACCGAAAATTTACACTG
Primer_r	: AACAGACTTTAAGAGAGGGAG
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2478 bp
Genome contig ID	gi42406306r_41627134
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCTTGTATACAGACATTAAAATTAGTGAGAGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATATCCTTGTGTCTTGGCTTTTACTTTTTGAAGTCATTAACAAATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	41727134	41731063	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1615

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information