| HUGE |
Gene/Protein Characteristic Table for KIAA1613 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00878 |
|---|---|
| Accession No. : | AB046833 |
| Description : | solute carrier family 7 (cationic amino acid transporter, y+ system), member 14. |
| HUGO Gene Name : | solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 (SLC7A14) |
| Clone Name : | fj12845 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1613
![]() |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4573 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2511 bp Genome contig ID gi89161205r_171565047 PolyA signal sequence
(GATAAA,-31) +----*----+----*----+----*----+----
AGTTGATAAATCACCTCCCTAGCAACCTTAGTTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAATCACTAAGATAGAAAAAGTATTTTCAGGTACATAGACATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 171665047 171727186 7 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 686 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GGCAAAATCTTAACGTGGGTG | |
| : ACTATGTGGGAAAAATGGCTC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |