HUGE

Gene/Protein Characteristic Table for KIAA1612

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00877
Accession No. :	AB046832
Description :	2-oxoglutarate and iron-dependent oxygenase domain-containing protein 1.
HUGO Gene Name :	2-oxoglutarate and iron-dependent oxygenase domain containing 1 (OGFOD1)
Clone Name :	fj12771 [Vector Info]
Flexi ORF Clone :	pF1KSDA1612
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4550 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2897 bp

Genome contig ID gi51511732f_54943002
PolyA signal sequence
(GATAAA,-25)
+----*----+----*----+----*----+----
ACCTCTTTCAGATAAAAGCTATGATGTTCACCTGT
Flanking genome sequence
(127513 - 127562)
----+----*----+----*----+----*----+----*----+----*
AAAATATATGGTTTCTCTCTTTATTCTTAATAGTGAGTCTCCAATTCTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 55043002 55070513 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N543	0	100.0	2-oxoglutarate ...	Homo sapiens
BAB13967	0	99.8	unnamed protein...	Homo sapiens
BAB14226	0	99.6	unnamed protein...	Homo sapiens
Q5R4R3	0	97.8	2-oxoglutarate ...	Pongo abelii
XP_535297	4.6e-206	88.6	similar to CG31...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005123 145 247 PF03171 2OG-Fe(II) oxygenase

HMMSmart IPR006620 56 246 SM00702 Prolyl 4-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005123	145	247	PF03171	2OG-Fe(II) oxygenase
HMMSmart	IPR006620	56	246	SM00702	Prolyl 4-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACATCATCTACAGCAGCAC

Primer_r
: CCTAAGAGTTGTTGACATTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2897 bp
Genome contig ID	gi51511732f_54943002
PolyA signal sequence (GATAAA,-25)	+--------+--------+----*----+---- ACCTCTTTCAGATAAAAGCTATGATGTTCACCTGT
Flanking genome sequence (127513 - 127562)	----+--------+--------+--------+--------+----* AAAATATATGGTTTCTCTCTTTATTCTTAATAGTGAGTCTCCAATTCTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	55043002	55070513	13	99.3	Perfect prediction

Primer_f	: TTACATCATCTACAGCAGCAC
Primer_r	: CCTAAGAGTTGTTGACATTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1612

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information