HUGE |
Gene/Protein Characteristic Table for KIAA1612 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00877 |
---|---|
Accession No. : | AB046832 |
Description : | 2-oxoglutarate and iron-dependent oxygenase domain-containing protein 1. |
HUGO Gene Name : | 2-oxoglutarate and iron-dependent oxygenase domain containing 1 (OGFOD1) |
Clone Name : | fj12771 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1612
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4550 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2897 bp Genome contig ID gi51511732f_54943002 PolyA signal sequence
(GATAAA,-25) +----*----+----*----+----*----+----
ACCTCTTTCAGATAAAAGCTATGATGTTCACCTGTFlanking genome sequence
(127513 - 127562) ----+----*----+----*----+----*----+----*----+----*
AAAATATATGGTTTCTCTCTTTATTCTTAATAGTGAGTCTCCAATTCTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 55043002 55070513 13 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 550 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR005123 | 145 | 247 | PF03171 | 2OG-Fe(II) oxygenase |
HMMSmart | IPR006620 | 56 | 246 | SM00702 | Prolyl 4-hydroxylase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTACATCATCTACAGCAGCAC | |
: CCTAAGAGTTGTTGACATTGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |