HUGE

Gene/Protein Characteristic Table for KIAA1595

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04733
Accession No. :	AB046815
Description :	ATP-dependent RNA helicase DDX55.
HUGO Gene Name :	DEAD (Asp-Glu-Ala-Asp) box polypeptide 55 (DDX55)
Clone Name :	fj09517 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4033 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 331 bp

Genome contig ID gi89161190f_122556961
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
GCGAGACCCTCTCATTAAAAACAACAAAACAAAAC
Flanking genome sequence
(114012 - 114061)
----+----*----+----*----+----*----+----*----+----*
AATTCCAGTCTTGGAGTAGTCTAACAGAAGAAAATGTAAAATTATTTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 122656881 122670971 9 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98421	7.9e-168	99.8	DEAD (Asp-Glu-A...	Homo sapiens
XP_001170185	1.5e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170205	1.6e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170244	1.7e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes
XP_001170267	1.8e-167	99.6	DEAD (Asp-Glu-A...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018344	1.6e-12	31.7	KIAA0801
D21853	1.5e-11	29.3	KIAA0111

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011545 7 83 PF00270 DNA/RNA helicase

IPR001650 159 234 PF00271 DNA/RNA helicase

HMMSmart IPR001650 152 234 SM00490 DNA/RNA helicase

ProfileScan IPR014021 1 94 PS51192 Helicase

IPR001650 125 273 PS51194 DNA/RNA helicase

ScanRegExp IPR000629 40 48 PS00039 RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011545	7	83	PF00270	DNA/RNA helicase
IPR001650	159	234	PF00271	DNA/RNA helicase
HMMSmart	IPR001650	152	234	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	1	94	PS51192	Helicase
IPR001650	125	273	PS51194	DNA/RNA helicase
ScanRegExp	IPR000629	40	48	PS00039	RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAGGGCGTGAAGATTATGTG

Primer_r
: ATTGCTGGGAGGGTCATACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: CCR
Primer_f	: GAAGGGCGTGAAGATTATGTG
Primer_r	: ATTGCTGGGAGGGTCATACTG
PCR product length	: 172(1.2k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	331 bp
Genome contig ID	gi89161190f_122556961
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GCGAGACCCTCTCATTAAAAACAACAAAACAAAAC
Flanking genome sequence (114012 - 114061)	----+--------+--------+--------+--------+----* AATTCCAGTCTTGGAGTAGTCTAACAGAAGAAAATGTAAAATTATTTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	122656881	122670971	9	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1595

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information