HUGE

Gene/Protein Characteristic Table for KIAA1552

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00862
Accession No. :	AB046772
Description :	FLYWCH-type zinc finger 1 isoform a.
HUGO Gene Name :
Clone Name :	fh16875 [Vector Info]
Flexi ORF Clone :	pF1KSDA1552
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4963 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2472 bp

Genome contig ID gi51511732f_2804177
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATCTCATGAAATTTAAAATAAATCCCCAAGGCATC
Flanking genome sequence
(137026 - 137075)
----+----*----+----*----+----*----+----*----+----*
AGAAACGTATCAACTAAGAACTCTAAGTTTGAAAATGGGGGTGGGGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 2902001 2941201 10 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW85450	100.0	FLYWCH-type zin...	Homo sapiens
Q4VC44	99.9	FLYWCH-type zin...	Homo sapiens
AAH28572	99.7	FLYWCH-type zin...	Homo sapiens
NP_065963	100.0	FLYWCH-type zin...	Homo sapiens
EAW85454	99.9	FLYWCH-type zin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007588 126 184 PF04500 Zinc finger

IPR007588 283 341 PF04500 Zinc finger

IPR007588 431 489 PF04500 Zinc finger

IPR007588 519 577 PF04500 Zinc finger

IPR007588 610 668 PF04500 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007588	126	184	PF04500	Zinc finger
IPR007588	283	341	PF04500	Zinc finger
IPR007588	431	489	PF04500	Zinc finger
IPR007588	519	577	PF04500	Zinc finger
IPR007588	610	668	PF04500	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAGGACGGAACCACTGCAC

Primer_r
: ATCTTGGTCGGAGGCTGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2472 bp
Genome contig ID	gi51511732f_2804177
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ATCTCATGAAATTTAAAATAAATCCCCAAGGCATC
Flanking genome sequence (137026 - 137075)	----+--------+--------+--------+--------+----* AGAAACGTATCAACTAAGAACTCTAAGTTTGAAAATGGGGGTGGGGCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	2902001	2941201	10	99.9	Perfect prediction

Primer_f	: TGAAGGACGGAACCACTGCAC
Primer_r	: ATCTTGGTCGGAGGCTGTGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1552

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information