HUGE

Gene/Protein Characteristic Table for KIAA1547

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00861
Accession No. :	AB046767
Description :	Transducin-like enhancer protein 3.
HUGO Gene Name :	transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) (TLE3)
Clone Name :	fh14154 [Vector Info]
Flexi ORF Clone :	pF1KSDA1547
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5205 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1821 bp

Genome contig ID gi51511731r_68027670
PolyA signal sequence
(AAGAAA,-15)
+----*----+----*----+----*----+----
AGAAGGGAGGGTGAGGGTAGAAGAAAGTTATTCTC
Flanking genome sequence
(99999 - 99950)
----+----*----+----*----+----*----+----*----+----*
CGAAGAAAAAAAGAATGAAAAGTCATTGTACTGAACTGTTTTTATATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 68127669 68177293 19 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 863 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10089	100.0	transducin-like...	synthetic construct
XP_001174941	99.9	transducin-like...	Pan troglodytes
XP_877614	99.3	similar to tran...	Bos taurus
EAW77848	98.8	transducin-like...	Homo sapiens
AAH43247	97.8	TLE3 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033087	8e-106	81.4	KIAA1261

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001680 705 738 PD000018 WD40 repeat

FPrintScan IPR001680 682 696 PR00320 WD40 repeat

IPR001680 724 738 PR00320 WD40 repeat

IPR009146 762 784 PR01850 Groucho/transducin-like enhancer

IPR009146 785 803 PR01850 Groucho/transducin-like enhancer

IPR009146 804 823 PR01850 Groucho/transducin-like enhancer

IPR001680 806 820 PR00320 WD40 repeat

IPR009146 824 843 PR01850 Groucho/transducin-like enhancer

IPR009146 844 863 PR01850 Groucho/transducin-like enhancer

HMMPfam IPR005617 104 239 PF03920 Groucho/TLE

IPR001680 568 604 PF00400 WD40 repeat

IPR001680 624 651 PF00400 WD40 repeat

IPR001680 657 695 PF00400 WD40 repeat

IPR001680 699 737 PF00400 WD40 repeat

IPR001680 781 819 PF00400 WD40 repeat

IPR001680 832 860 PF00400 WD40 repeat

HMMSmart IPR001680 567 604 SM00320 WD40 repeat

IPR001680 610 651 SM00320 WD40 repeat

IPR001680 656 695 SM00320 WD40 repeat

IPR001680 698 737 SM00320 WD40 repeat

IPR001680 740 778 SM00320 WD40 repeat

IPR001680 780 819 SM00320 WD40 repeat

IPR001680 820 860 SM00320 WD40 repeat

ProfileScan IPR001680 573 746 PS50294 WD40 repeat

IPR001680 663 704 PS50082 WD40 repeat

IPR001680 705 746 PS50082 WD40 repeat

IPR001680 787 863 PS50294 WD40 repeat

ScanRegExp IPR001680 682 696 PS00678 WD40 repeat

IPR001680 724 738 PS00678 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	705	738	PD000018	WD40 repeat
FPrintScan	IPR001680	682	696	PR00320	WD40 repeat
IPR001680	724	738	PR00320	WD40 repeat
IPR009146	762	784	PR01850	Groucho/transducin-like enhancer
IPR009146	785	803	PR01850	Groucho/transducin-like enhancer
IPR009146	804	823	PR01850	Groucho/transducin-like enhancer
IPR001680	806	820	PR00320	WD40 repeat
IPR009146	824	843	PR01850	Groucho/transducin-like enhancer
IPR009146	844	863	PR01850	Groucho/transducin-like enhancer
HMMPfam	IPR005617	104	239	PF03920	Groucho/TLE
IPR001680	568	604	PF00400	WD40 repeat
IPR001680	624	651	PF00400	WD40 repeat
IPR001680	657	695	PF00400	WD40 repeat
IPR001680	699	737	PF00400	WD40 repeat
IPR001680	781	819	PF00400	WD40 repeat
IPR001680	832	860	PF00400	WD40 repeat
HMMSmart	IPR001680	567	604	SM00320	WD40 repeat
IPR001680	610	651	SM00320	WD40 repeat
IPR001680	656	695	SM00320	WD40 repeat
IPR001680	698	737	SM00320	WD40 repeat
IPR001680	740	778	SM00320	WD40 repeat
IPR001680	780	819	SM00320	WD40 repeat
IPR001680	820	860	SM00320	WD40 repeat
ProfileScan	IPR001680	573	746	PS50294	WD40 repeat
IPR001680	663	704	PS50082	WD40 repeat
IPR001680	705	746	PS50082	WD40 repeat
IPR001680	787	863	PS50294	WD40 repeat
ScanRegExp	IPR001680	682	696	PS00678	WD40 repeat
IPR001680	724	738	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGCATATTCCAGTCTAAAG

Primer_r
: GCTGGAGTTCTTGTTTAGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1821 bp
Genome contig ID	gi51511731r_68027670
PolyA signal sequence (AAGAAA,-15)	+--------+--------+----*----+---- AGAAGGGAGGGTGAGGGTAGAAGAAAGTTATTCTC
Flanking genome sequence (99999 - 99950)	----+--------+--------+--------+--------+----* CGAAGAAAAAAAGAATGAAAAGTCATTGTACTGAACTGTTTTTATATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	68127669	68177293	19	99.0	Perfect prediction

Primer_f	: CCAGCATATTCCAGTCTAAAG
Primer_r	: GCTGGAGTTCTTGTTTAGTAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1547

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information