HUGE

Gene/Protein Characteristic Table for KIAA1526

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040959
Description :	Whirlin.
HUGO Gene Name :
Clone Name :	fj04743 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4762 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 673 bp

Genome contig ID gi89161216r_116104182
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CTTTAATTTTTCAATAAAGAAATCTGAACAAGGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACGTCAGCGTGCTGTGTGGTTTACCTGGGTGGCTGGGGTTTCCATGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 116204182 116307071 12 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 963 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001096493	96.6	similar to CASK...	Macaca mulatta
XP_001145880	98.5	CASK-interactin...	Pan troglodytes
Q9P202	100.0	Whirlin; Autoso...	Homo sapiens
NP_056219	99.9	CASK-interactin...	Homo sapiens
AAI42685	99.8	Deafness, autos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 196 275 PF00595 PDZ/DHR/GLGF

IPR001478 335 413 PF00595 PDZ/DHR/GLGF

IPR001478 872 943 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 206 278 SM00228 PDZ/DHR/GLGF

IPR001478 344 416 SM00228 PDZ/DHR/GLGF

IPR001478 880 960 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001478 196 271 PS50106 PDZ/DHR/GLGF

IPR001478 335 405 PS50106 PDZ/DHR/GLGF

IPR001478 872 943 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	196	275	PF00595	PDZ/DHR/GLGF
IPR001478	335	413	PF00595	PDZ/DHR/GLGF
IPR001478	872	943	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	206	278	SM00228	PDZ/DHR/GLGF
IPR001478	344	416	SM00228	PDZ/DHR/GLGF
IPR001478	880	960	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	196	271	PS50106	PDZ/DHR/GLGF
IPR001478	335	405	PS50106	PDZ/DHR/GLGF
IPR001478	872	943	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGAAGGTCAGGTCAGGAAC

Primer_r
: TTGGACAAAGGCTCAGGCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGAAGGTCAGGTCAGGAAC
Primer_r	: TTGGACAAAGGCTCAGGCATC
PCR product length	: 190 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	673 bp
Genome contig ID	gi89161216r_116104182
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTTAATTTTTCAATAAAGAAATCTGAACAAGGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACGTCAGCGTGCTGTGTGGTTTACCTGGGTGGCTGGGGTTTCCATGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	116204182	116307071	12	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1526

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information