HUGE

Gene/Protein Characteristic Table for KIAA1522

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040955
Description :
HUGO Gene Name :
Clone Name :	fh14706 [Vector Info]
Flexi ORF Clone :	pF1KA1522
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5053 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2083 bp

Genome contig ID gi89161185f_32903855
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TCATTTAAAGATGTTAATTAAATGATTGAAACTTG
Flanking genome sequence
(109305 - 109354)
----+----*----+----*----+----*----+----*----+----*
GCTGTGGCTACTGCTTCTTAATGTGGGGGGGACAGGGCAGTGGTCTGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 33003855 33013158 7 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1044 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001164540	0	99.3	hypothetical pr...	Pan troglodytes
XP_001104571	0	96.1	hypothetical pr...	Macaca mulatta
BAE20526	3.5e-147	80.7	unnamed protein...	Mus musculus
EDL30208	6.2e-147	80.5	expressed seque...	Mus musculus
BAE32933	1.1e-144	80.6	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	7.4e-06	25.7	KIAA1681
AB007927	0.00015	25.8	KIAA0458
AB002304	0.00053	25.7	KIAA0306

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAACATTACTGGAACTCTATC

Primer_r
: TCTCTCCATTTACTCTAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	2083 bp
Genome contig ID	gi89161185f_32903855
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TCATTTAAAGATGTTAATTAAATGATTGAAACTTG
Flanking genome sequence (109305 - 109354)	----+--------+--------+--------+--------+----* GCTGTGGCTACTGCTTCTTAATGTGGGGGGGACAGGGCAGTGGTCTGGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	33003855	33013158	7	99.5	Perfect prediction

Primer_f	: CAACATTACTGGAACTCTATC
Primer_r	: TCTCTCCATTTACTCTAGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1522

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information