HUGE |
Gene/Protein Characteristic Table for KIAA1499 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00853 |
---|---|
Accession No. : | AB040932 |
Description : | Nuclear protein localization protein 4 homolog. |
HUGO Gene Name : | nuclear protein localization 4 homolog (S. cerevisiae) (NPLOC4) |
Clone Name : | hh04716 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1499
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5551 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3567 bp Genome contig ID gi51511734r_77039376 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ATGGTGAAGCCCCGTCTGTACAAAAAAACAATATTFlanking genome sequence
(99860 - 99811) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAATTAGCTGGGCATGGTGAGTGGTCCACGCCTATAATCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 77139236 77214491 16 97.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 660 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007716 | 147 | 289 | PF05020 | NPL4 |
IPR007717 | 291 | 600 | PF05021 | NPL4 |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGTCCAGGCCGTACGTCTTAG | |
: ACTAAAGGGAAATTCTCAAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: CCR | |
: TGTCCAGGCCGTACGTCTTAG | |
: ACTAAAGGGAAATTCTCAAGG | |
: 181 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |