HUGE |
Gene/Protein Characteristic Table for KIAA1492 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00240 |
---|---|
Accession No. : | AB040925 |
Description : | Inactive dipeptidyl peptidase 10. |
HUGO Gene Name : | |
Clone Name : | bj00389 [Vector Info] |
Flexi ORF Clone : | pF1KA1492
![]() |
Source : | Human adult brain |
Note : | We replaced fj08453, former representative clones for KIAA1492 with bj00389. (2001/2/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4394 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2015 bp Genome contig ID gi89161199f_115536272 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAGTATCATTTAAAAAGTATTTGCCTTTTACTGTCFlanking genome sequence
(782136 - 782185) ----+----*----+----*----+----*----+----*----+----*
ATCATTTCTCTTGTTTTATTATTATTATCAATGTTTATCTATTTTTCAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 115783283 116318406 23 99.4 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 792 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 2 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |