HUGE |
Gene/Protein Characteristic Table for KIAA1453 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00841 |
---|---|
Accession No. : | AB040886 |
Description : | Ubiquitin carboxyl-terminal hydrolase 36. |
HUGO Gene Name : | ubiquitin specific peptidase 36 (USP36) |
Clone Name : | fh14729 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1453
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5879 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2295 bp Genome contig ID gi51511734r_74195144 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TACATTGATTTTGATTACAAATGGTTCTGTATTATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATACCACCGTTCTGACTGCTTTTTTCACTTATAGCTTGGAAATTGTCTTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 74295144 74348457 21 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1123 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001394 | 121 | 422 | PF00443 | Peptidase C19 |
ProfileScan | IPR001394 | 124 | 426 | PS50235 | Peptidase C19 |
ScanRegExp | IPR001394 | 125 | 140 | PS00972 | Peptidase C19 |
IPR001394 | 367 | 385 | PS00973 | Peptidase C19 | |
IPR003006 | 378 | 384 | PS00290 | Immunoglobulin/major histocompatibility complex motif |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTGGCTGCTCTTCATTGACC | |
: TACATGCTACTCGTTTACAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: CCR | |
: TCTGGCTGCTCTTCATTGACC | |
: TACATGCTACTCGTTTACAGG | |
: 104 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |