HUGE

Gene/Protein Characteristic Table for KIAA1450

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01168
Accession No. :	AB040883
Description :
HUGO Gene Name :	folliculin interacting protein 2 (FNIP2)
Clone Name :	fh12401b [Vector Info]
Flexi ORF Clone :	pF1KA1450
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4570 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1150 bp

Genome contig ID gi89161207f_159809740
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAAACCGACCAAAATGATTTCCTAAAGTTCATGC
Flanking genome sequence
(236558 - 236607)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAACAACCTAATTTTCTGTTAATATAAAAGAAACTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 159909740 160046296 17 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1139 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001498983	84.5	folliculin inte...	Equus caballus
XP_227287	78.4	similar to CG37...	Rattus norvegicus
Q80TD3	78.3	Folliculin-inte...	Mus musculus
XP_001510294	67.3	similar to hCG1...	Ornithorhynchus...
EDL15464	72.9	mCG20638 [Mus m...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075841	2.2e-72	50.3	KIAA1961

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACCCAAGAATCAATGTAGCC

Primer_r
: AGAACTTACCAACCGAAACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACCCAAGAATCAATGTAGCC
Primer_r	: AGAACTTACCAACCGAAACAC
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1150 bp
Genome contig ID	gi89161207f_159809740
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAAACCGACCAAAATGATTTCCTAAAGTTCATGC
Flanking genome sequence (236558 - 236607)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAACAACCTAATTTTCTGTTAATATAAAAGAAACTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	159909740	160046296	17	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1450

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information