HUGE

Gene/Protein Characteristic Table for KIAA1426

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01164
Accession No. :	AB037847
Description :	Protein cramped-like.
HUGO Gene Name :	hematological and neurological expressed 1-like (HN1L)
Clone Name :	fg04231s1 [Vector Info]
Flexi ORF Clone :	pF1KA1426
Source :	Human fetal brain
Note :	We replaced fg04231, former representative clones for KIAA1426 with fg04231s1. (2000/3/14)

Features of the cloned DNA sequence	Description

Length: 7064 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3861 bp

Genome contig ID gi51511732f_1522281
PolyA signal sequence
(CATAAA,-25)
+----*----+----*----+----*----+----
TTTTATTGTGCATAAATACATACTAATGTTGATCT
Flanking genome sequence
(145629 - 145678)
----+----*----+----*----+----*----+----*----+----*
AAGGACTGTCGTTTGTGCCTGTTCTTCAGGGCCGCGCGCCCATGCCCGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 1622281 1667908 18 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1066 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52478	100.0	Crm, cramped-li...	Homo sapiens
Q96RY5	99.8	Protein cramped...	Homo sapiens
CAM26477	99.8	Crm, cramped-li...	Homo sapiens
AAI37173	99.8	Crm, cramped-li...	Homo sapiens
XP_598762	84.3	similar to Prot...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTCTTGTAGCTGTAGGGTGCC
Primer_r	: GTTATCCACCAGAAATGAGGC
PCR product length	: 129 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3861 bp
Genome contig ID	gi51511732f_1522281
PolyA signal sequence (CATAAA,-25)	+--------+--------+----*----+---- TTTTATTGTGCATAAATACATACTAATGTTGATCT
Flanking genome sequence (145629 - 145678)	----+--------+--------+--------+--------+----* AAGGACTGTCGTTTGTGCCTGTTCTTCAGGGCCGCGCGCCCATGCCCGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	1622281	1667908	18	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1426

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information