| HUGE |
Gene/Protein Characteristic Table for KIAA1408 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | |
|---|---|
| Accession No. : | AB037829 |
| Description : | Regulator of nonsense transcripts 2. |
| HUGO Gene Name : | UPF2 regulator of nonsense transcripts homolog (yeast) (UPF2) |
| Clone Name : | fh04333 [Vector Info] |
| Flexi ORF Clone : | pF1KA1408
|
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5384 bp
|
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
| cloned DNA seq. | ||
Warning for N-terminal truncation: | NO | NO |
Warning for coding interruption: | YES | NO |
Length of 3'UTR 1275 bp Genome contig ID gi89161187r_11902028 PolyA signal sequence
(AATAAA,-18)
ACCTTTGCCGATGCTGCAATAAAGTGTTGTAATTTFlanking genome sequence
(100000 - 99951)
AGATTTGGCGTGGTGTTGTTTTGTTGGGTTTGGGTTTTGGAAACCGATTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 12002028 12117902 21 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1298 aa
This protein sequence is predicted from the revised DNA sequence
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR003890 | 194 | 457 | PF02854 | MIF4G-like |
| IPR003890 | 595 | 784 | PF02854 | MIF4G-like | |
| IPR003890 | 802 | 1012 | PF02854 | MIF4G-like | |
| IPR007193 | 1062 | 1244 | PF04050 | Up-frameshift suppressor 2 | |
| HMMSmart | IPR003890 | 194 | 390 | SM00543 | MIF4G-like |
| IPR003890 | 595 | 784 | SM00543 | MIF4G-like | |
| IPR003890 | 799 | 1012 | SM00543 | MIF4G-like |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AGATGGTTCACTTGACTACTG | |
| : AATGTATCTTCTTCCAACGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
