HUGE |
Gene/Protein Characteristic Table for KIAA1405 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05750 |
---|---|
Accession No. : | AB037826 |
Description : | Kinesin-like protein KIF17. |
HUGO Gene Name : | kinesin family member 17 (KIF17) |
Clone Name : | fg03134s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1405
![]() |
Source : | Human fetal brain |
Note : | We replaced fg03134, former representative clones for KIAA1405 with fg03134s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3570 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 568 bp Genome contig ID gi89161185r_20763096 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
CCACATTAAGCTGCCCAATAAACTGCTTTTAAGATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGCTCCCCTTCTCTGACCCTCTGACAGTGTCACTTGGGGCCCCTCCCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 20863096 20916571 15 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 993 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 46 | 67 | PR00380 | Kinesin |
IPR001752 | 165 | 182 | PR00380 | Kinesin | |
IPR001752 | 199 | 217 | PR00380 | Kinesin | |
IPR001752 | 249 | 270 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 6 | 300 | PF00225 | Kinesin |
HMMSmart | IPR001752 | 6 | 307 | SM00129 | Kinesin |
ProfileScan | IPR001752 | 41 | 229 | PS50067 | Kinesin |
ScanRegExp | IPR001752 | 198 | 209 | PS00411 | Kinesin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAAGATTCTGCGTGAGTCCTG | |
: TTTTCACTGTTGCTCCGACTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |