HUGE

Gene/Protein Characteristic Table for KIAA1398

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06702
Accession No. :	AB037819
Description :	Ribosome-binding protein 1.
HUGO Gene Name :
Clone Name :	ha02572 [Vector Info]
Flexi ORF Clone :	pF1KA1398
Source :	Myeloblast cell line (KG-1)
Note :	We replaced hk01703, former representative clones for KIAA1398 with ha02572. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 5468 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 501 bp

Genome contig ID gi51511747r_17442325
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
GTGTTGATGCCATTAAAACCAACGTTGGTGCCCGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCTGCGGTCTCGTCTGGTCTTCTGCTGGGGCTCCCCCACCCGCTGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 17542325 17610847 26 99.0 Both No-hit

Features of the protein sequence	Description

Length: 1586 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10454	100.0	ribosome-bindin...	synthetic construct
BAF73807	97.2	p180/ribosome r...	Homo sapiens
Q9P2E9	90.2	Ribosome-bindin...	Homo sapiens
Q99PL5	79.3	Ribosome-bindin...	Mus musculus
CAM26890	78.0	ribosome bindin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	5.9e-10	26.1	KIAA0004
AB029041	0.00025	21.1	KIAA1118
AB007914	0.00087	24.9	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 417 616 PD028462 NULL

HMMPfam IPR007794 59 202 PF05104 Ribosome receptor lysine or proline rich

IPR002989 257 296 PF01469 Mycobacterial pentapeptide repeat

IPR002989 327 366 PF01469 Mycobacterial pentapeptide repeat

IPR002989 367 406 PF01469 Mycobacterial pentapeptide repeat

IPR002989 427 466 PF01469 Mycobacterial pentapeptide repeat

IPR002989 477 516 PF01469 Mycobacterial pentapeptide repeat

IPR002989 537 576 PF01469 Mycobacterial pentapeptide repeat

IPR002989 577 616 PF01469 Mycobacterial pentapeptide repeat

IPR002989 617 656 PF01469 Mycobacterial pentapeptide repeat

IPR002989 657 696 PF01469 Mycobacterial pentapeptide repeat

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	417	616	PD028462	NULL
HMMPfam	IPR007794	59	202	PF05104	Ribosome receptor lysine or proline rich
IPR002989	257	296	PF01469	Mycobacterial pentapeptide repeat
IPR002989	327	366	PF01469	Mycobacterial pentapeptide repeat
IPR002989	367	406	PF01469	Mycobacterial pentapeptide repeat
IPR002989	427	466	PF01469	Mycobacterial pentapeptide repeat
IPR002989	477	516	PF01469	Mycobacterial pentapeptide repeat
IPR002989	537	576	PF01469	Mycobacterial pentapeptide repeat
IPR002989	577	616	PF01469	Mycobacterial pentapeptide repeat
IPR002989	617	656	PF01469	Mycobacterial pentapeptide repeat
IPR002989	657	696	PF01469	Mycobacterial pentapeptide repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 34 TLGVVVFGGFMVVSAIGIFLVST 56 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	TLGVVVFGGFMVVSAIGIFLVST	56	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTGAAGAACAATGACCTCCG

Primer_r
: CTCGGTGTAATTCTGTTGTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGCAATTAGCTCCCTCCTCC
Primer_r	: AGAGACTCCAACTATGCCATG
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	501 bp
Genome contig ID	gi51511747r_17442325
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GTGTTGATGCCATTAAAACCAACGTTGGTGCCCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTGCGGTCTCGTCTGGTCTTCTGCTGGGGCTCCCCCACCCGCTGTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	17542325	17610847	26	99.0	Both No-hit

Primer_f	: AGTGAAGAACAATGACCTCCG
Primer_r	: CTCGGTGTAATTCTGTTGTGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1398

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information