HUGE

Gene/Protein Characteristic Table for KIAA1385

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00225
Accession No. :	AB037806
Description :	Gephyrin.
HUGO Gene Name :	gephyrin (GPHN)
Clone Name :	fj06168 [Vector Info]
Flexi ORF Clone :	pF1KA1385
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4193 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 861 bp

Genome contig ID gi51511730f_65943878
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
ACTTAATGAATAAAAAAATTCCTTGATCATTATTT
Flanking genome sequence
(774392 - 774441)
----+----*----+----*----+----*----+----*----+----*
AAAAATGTAATGTGTTGGCCTCGTTATTTAAAGAGAGAAGATTGTCATGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 66043878 66718268 20 99.7 Internal No-hit

Features of the protein sequence	Description

Length: 768 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NQX3	100.0	Gephyrin.	Homo sapiens
CAA47009	99.9	Gephyrin [Rattu...	Rattus norvegicus
CAC81240	99.9	gephyrin [Homo ...	Homo sapiens
EDM03692	99.7	rCG61772, isofo...	Rattus norvegicus
Q9PW38	98.5	Gephyrin.	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001453 539 680 PD002460 Molybdopterin binding domain

HMMPfam IPR001453 50 196 PF00994 Molybdopterin binding domain

IPR005110 355 521 PF03453 MoeA

IPR001453 534 677 PF00994 Molybdopterin binding domain

IPR005111 690 766 PF03454 MoeA

HMMTigr IPR001453 46 192 TIGR00177 Molybdopterin binding domain

IPR001453 530 673 TIGR00177 Molybdopterin binding domain

ScanRegExp IPR008284 113 126 PS01078 Molybdenum cofactor biosynthesis protein

IPR008284 607 642 PS01079 Molybdenum cofactor biosynthesis protein

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001453	539	680	PD002460	Molybdopterin binding domain
HMMPfam	IPR001453	50	196	PF00994	Molybdopterin binding domain
IPR005110	355	521	PF03453	MoeA
IPR001453	534	677	PF00994	Molybdopterin binding domain
IPR005111	690	766	PF03454	MoeA
HMMTigr	IPR001453	46	192	TIGR00177	Molybdopterin binding domain
IPR001453	530	673	TIGR00177	Molybdopterin binding domain
ScanRegExp	IPR008284	113	126	PS01078	Molybdenum cofactor biosynthesis protein
IPR008284	607	642	PS01079	Molybdenum cofactor biosynthesis protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAAAGCAAGGTTATCATGTG

Primer_r
: GTACTGTTCTGTCTTTGGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	861 bp
Genome contig ID	gi51511730f_65943878
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACTTAATGAATAAAAAAATTCCTTGATCATTATTT
Flanking genome sequence (774392 - 774441)	----+--------+--------+--------+--------+----* AAAAATGTAATGTGTTGGCCTCGTTATTTAAAGAGAGAAGATTGTCATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	66043878	66718268	20	99.7	Internal No-hit

Primer_f	: TCAAAGCAAGGTTATCATGTG
Primer_r	: GTACTGTTCTGTCTTTGGAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1385

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information