HUGE

Gene/Protein Characteristic Table for KIAA1373

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00221
Accession No. :	AB037794
Description :	AMSH-like protease.
HUGO Gene Name :	STAM binding protein-like 1 (STAMBPL1)
Clone Name :	fj03723 [Vector Info]
Flexi ORF Clone :	pF1KA1373
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4052 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1840 bp

Genome contig ID gi89161187f_90529603
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAGTGAAAGTGAAACCAGAATGCTGTCAACGATT
Flanking genome sequence
(195289 - 195338)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACTCTCAAGCAAGAGCAAACAATGATACTGCCTCTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 90629603 90724890 11 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 463 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI13862	6.4e-177	100.0	novel Mov34/MPN...	Homo sapiens
XP_001140148	1.1e-176	99.8	associated mole...	Pan troglodytes
XP_001083976	2.7e-172	97.8	similar to asso...	Macaca mulatta
Q96FJ0	1.5e-160	99.8	AMSH-like prote...	Homo sapiens
XP_001140564	2.5e-160	99.5	associated mole...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000555 266 375 PF01398 Mov34/MPN/PAD-1

HMMSmart IPR000555 270 396 SM00232 Mov34/MPN/PAD-1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000555	266	375	PF01398	Mov34/MPN/PAD-1
HMMSmart	IPR000555	270	396	SM00232	Mov34/MPN/PAD-1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGGTGAAATTGATGGTGGAGC

Primer_r
: GCAGAAAAAGCTCGCAGGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGGTGAAATTGATGGTGGAGC
Primer_r	: GCAGAAAAAGCTCGCAGGTGG
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1840 bp
Genome contig ID	gi89161187f_90529603
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGTGAAAGTGAAACCAGAATGCTGTCAACGATT
Flanking genome sequence (195289 - 195338)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACTCTCAAGCAAGAGCAAACAATGATACTGCCTCTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	90629603	90724890	11	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1373

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information