HUGE

Gene/Protein Characteristic Table for KIAA1372

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00220
Accession No. :	AB037793
Description :	Ubiquitin carboxyl-terminal hydrolase 35.
HUGO Gene Name :	ubiquitin specific peptidase 35 (USP35)
Clone Name :	fj03335 [Vector Info]
Flexi ORF Clone :	pF1KA1372
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3771 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 895 bp

Genome contig ID gi51511727f_77487664
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CCCATGTTCATAAATAAATAAAAGTAAGCCTAAGC
Flanking genome sequence
(115739 - 115788)
----+----*----+----*----+----*----+----*----+----*
AAGAGATTGTTCTTCCTTGGACTCAGGGGCTGTGATGGCCACTGGGTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 77587664 77603401 8 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 773 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_065849	99.5	ubiquitin speci...	Homo sapiens
Q9P2H5	99.3	Ubiquitin carbo...	Homo sapiens
BAG11313	100.0	ubiquitin carbo...	synthetic construct
EAW75056	99.9	hCG27473 [Homo ...	Homo sapiens
XP_891616	85.2	ubiquitin speci...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067478	1e-34	43.8	KIAA1891

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001394 193 678 PF00443 Peptidase C19

ProfileScan IPR001394 196 682 PS50235 Peptidase C19

ScanRegExp IPR001394 197 212 PS00972 Peptidase C19

IPR001394 600 618 PS00973 Peptidase C19

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	193	678	PF00443	Peptidase C19
ProfileScan	IPR001394	196	682	PS50235	Peptidase C19
ScanRegExp	IPR001394	197	212	PS00972	Peptidase C19
IPR001394	600	618	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTATCCCCCTTGTGGTTAGAG

Primer_r
: ACAAAGGCCAACTGCTCAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTCTCTTTCGACCTGCGCAC
Primer_r	: CATAGCAGTAGTAGTGACCAC
PCR product length	: 170 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	895 bp
Genome contig ID	gi51511727f_77487664
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCCATGTTCATAAATAAATAAAAGTAAGCCTAAGC
Flanking genome sequence (115739 - 115788)	----+--------+--------+--------+--------+----* AAGAGATTGTTCTTCCTTGGACTCAGGGGCTGTGATGGCCACTGGGTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	77587664	77603401	8	99.7	Perfect prediction

Primer_f	: GTATCCCCCTTGTGGTTAGAG
Primer_r	: ACAAAGGCCAACTGCTCAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1372

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information