HUGE

Gene/Protein Characteristic Table for KIAA1363

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00815
Accession No. :	AB037784
Description :	Arylacetamide deacetylase-like 1.
HUGO Gene Name :	arylacetamide deacetylase-like 1 (AADACL1)
Clone Name :	fj02385 [Vector Info]
Flexi ORF Clone :	pF1KSDA1363
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4116 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2822 bp

Genome contig ID gi89161205r_173731141
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GAATCATGTTTGGAAATAAAATTGCTCCATCTGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTGCTTTCATTTTCCCGTCTCATTTTCTGTTTCCCATTTGAAAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 173831141 173911535 5 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 430 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH28734	1e-183	99.8	Arylacetamide d...	Homo sapiens
BAH14802	1.6e-183	99.5	unnamed protein...	Homo sapiens
EAW78462	2.6e-183	99.5	arylacetamide d...	Homo sapiens
AAH47588	3e-183	99.3	AADACL1 protein...	Homo sapiens
BAH13028	4.9e-183	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013094 131 404 PF07859 Alpha/beta hydrolase fold-3

ScanRegExp IPR002168 207 219 PS01174 Lipolytic enzyme

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013094	131	404	PF07859	Alpha/beta hydrolase fold-3
ScanRegExp	IPR002168	207	219	PS01174	Lipolytic enzyme

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACTCATACCTACAGCTACAG

Primer_r
: AATACTGCTCTGAACTCAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2822 bp
Genome contig ID	gi89161205r_173731141
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAATCATGTTTGGAAATAAAATTGCTCCATCTGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGCTTTCATTTTCCCGTCTCATTTTCTGTTTCCCATTTGAAAACAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	173831141	173911535	5	99.1	Perfect prediction

Primer_f	: TACTCATACCTACAGCTACAG
Primer_r	: AATACTGCTCTGAACTCAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1363

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information