HUGE

Gene/Protein Characteristic Table for KIAA1357

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07590
Accession No. :	AB037778
Description :	NHS-like protein 1.
HUGO Gene Name :	NHS-like 1 (NHSL1)
Clone Name :	fj01906 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4022 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1509 bp

Genome contig ID gi89161210r_138685401
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTTGTTAAATAAACTAGAGTATTGTCTTCTTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAAGGACCTAGGATGACAATGCGGAGAGTCTTGGTCTGAATCTAGTGCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 138785401 138794866 3 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 836 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW47916	6.9e-214	100.0	hCG18281, isofo...	Homo sapiens
NP_001137532	7e-214	100.0	NHS-like 1 [Hom...	Homo sapiens
Q5SYE7	7e-214	100.0	NHS-like protein 1.	Homo sapiens
XP_001095123	6e-203	95.6	similar to NHS-...	Macaca mulatta
XP_001095017	6e-203	95.6	similar to NHS-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040955	0.00065	30.3	KIAA1522

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTGAAGTGATGGTGTGGAC

Primer_r
: CCCATAGTTCTGTAGTGCAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1509 bp
Genome contig ID	gi89161210r_138685401
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTTGTTAAATAAACTAGAGTATTGTCTTCTTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAGGACCTAGGATGACAATGCGGAGAGTCTTGGTCTGAATCTAGTGCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	138785401	138794866	3	99.4	Perfect prediction

Primer_f	: AACTGAAGTGATGGTGTGGAC
Primer_r	: CCCATAGTTCTGTAGTGCAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1357

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information