HUGE

Gene/Protein Characteristic Table for KIAA1336

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01160
Accession No. :	AB037757
Description :	WD repeat protein 35.
HUGO Gene Name :	WD repeat domain 35 (WDR35)
Clone Name :	bg00080 [Vector Info]
Flexi ORF Clone :	pF1KA1336
Source :	Human adult brain
Note :	We replaced fh16186, former representative clones for KIAA1336 with bg00080. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6950 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3288 bp

Genome contig ID gi89161199r_19873512
PolyA signal sequence
(AATAAA,-14)
+----*----+----*----+----*----+----
TAAGTGAAAAAATACGAAAATAATAAACATTGAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAATAACTTGTGTTTATTCCACGTTTTCTTTATCTATAACTTACGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 19973512 20053373 28 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515315	99.5	WD repeat domai...	Pan troglodytes
XP_001107482	98.1	WD repeat domai...	Macaca mulatta
Q9P2L0	100.0	WD repeat-conta...	Homo sapiens
XP_532884	94.2	similar to WD r...	Canis lupus fam...
XP_001072062	92.8	similar to WD r...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037818	5.1e-18	29.3	KIAA1397

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 57 80 PF00400 WD40 repeat

IPR001680 99 137 PF00400 WD40 repeat

HMMSmart IPR001680 42 80 SM00320 WD40 repeat

IPR001680 98 137 SM00320 WD40 repeat

IPR001680 142 181 SM00320 WD40 repeat

IPR001680 185 222 SM00320 WD40 repeat

IPR001680 531 568 SM00320 WD40 repeat

ProfileScan IPR001680 105 136 PS50082 WD40 repeat

IPR001680 105 190 PS50294 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	57	80	PF00400	WD40 repeat
IPR001680	99	137	PF00400	WD40 repeat
HMMSmart	IPR001680	42	80	SM00320	WD40 repeat
IPR001680	98	137	SM00320	WD40 repeat
IPR001680	142	181	SM00320	WD40 repeat
IPR001680	185	222	SM00320	WD40 repeat
IPR001680	531	568	SM00320	WD40 repeat
ProfileScan	IPR001680	105	136	PS50082	WD40 repeat
IPR001680	105	190	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCTCCTGTTGAACTTGCATC

Primer_r
: ATGGACTAAGAATTGCAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3288 bp
Genome contig ID	gi89161199r_19873512
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- TAAGTGAAAAAATACGAAAATAATAAACATTGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAATAACTTGTGTTTATTCCACGTTTTCTTTATCTATAACTTACGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	19973512	20053373	28	99.5	Perfect prediction

Primer_f	: ATCTCCTGTTGAACTTGCATC
Primer_r	: ATGGACTAAGAATTGCAGCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1336

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information