HUGE

Gene/Protein Characteristic Table for KIAA1330

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04088
Accession No. :	AB037751
Description :	Alpha-protein kinase 3.
HUGO Gene Name :	alpha-kinase 3 (ALPK3)
Clone Name :	fh15188 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5577 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2737 bp

Genome contig ID gi51511731f_83101252
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGTGAGTGAACATATCAATAAAGACAACCTGAACC
Flanking genome sequence
(116460 - 116509)
----+----*----+----*----+----*----+----*----+----*
AAAATTATATCTTGGTCATACAGCCTTTAAAAGGTCCACCACAGACTGCG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 83201252 83217710 10 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 945 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96L96	0	100.0	Alpha-protein k...	Homo sapiens
EAX01960	0	99.9	alpha-kinase 3 ...	Homo sapiens
NP_065829	0	99.9	alpha-kinase 3 ...	Homo sapiens
XP_001498391	0	83.9	alpha-kinase 3 ...	Equus caballus
XP_536201	4.4e-185	79.3	similar to alph...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004166 659 857 PF02816 MHCK/EF2 kinase

HMMSmart IPR004166 660 857 SM00811 MHCK/EF2 kinase

ProfileScan IPR007110 514 602 PS50835 Immunoglobulin-like

IPR004166 630 865 PS51158 MHCK/EF2 kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004166	659	857	PF02816	MHCK/EF2 kinase
HMMSmart	IPR004166	660	857	SM00811	MHCK/EF2 kinase
ProfileScan	IPR007110	514	602	PS50835	Immunoglobulin-like
IPR004166	630	865	PS51158	MHCK/EF2 kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATACCCAGGTGAGGAACAGAC

Primer_r
: TTCAGTATGGAGTGCAAGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2737 bp
Genome contig ID	gi51511731f_83101252
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GGTGAGTGAACATATCAATAAAGACAACCTGAACC
Flanking genome sequence (116460 - 116509)	----+--------+--------+--------+--------+----* AAAATTATATCTTGGTCATACAGCCTTTAAAAGGTCCACCACAGACTGCG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	83201252	83217710	10	99.3	Perfect prediction

Primer_f	: ATACCCAGGTGAGGAACAGAC
Primer_r	: TTCAGTATGGAGTGCAAGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1330

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information