HUGE

Gene/Protein Characteristic Table for KIAA1321

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00213
Accession No. :	AB037742
Description :	Nuclear fragile X mental retardation-interacting protein 2.
HUGO Gene Name :	nuclear fragile X mental retardation protein interacting protein 2 (NUFIP2)
Clone Name :	fh13788 [Vector Info]
Flexi ORF Clone :	pF1KA1321
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5058 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2911 bp

Genome contig ID gi51511734r_24512792
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
TACAGAGCACTTATTAAAAAAAAATCTTAAGAGTT
Flanking genome sequence
(99980 - 99931)
----+----*----+----*----+----*----+----*----+----*
GATCTGTTTTCTGATTATTTTGTGTAAGCTTCTAAACAAACTTCAGCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 24612772 24645262 4 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 714 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511374	99.7	82-kD FMRP Inte...	Pan troglodytes
Q7Z417	100.0	Nuclear fragile...	Homo sapiens
XP_001110992	99.0	similar to 82-k...	Macaca mulatta
XP_001918376	96.4	nuclear fragile...	Equus caballus
XP_001250303	95.3	similar to nucl...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGTATTTTGGGGGCATTAGG

Primer_r
: AGTGCTCTGTAAGGAATTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGTATTTTGGGGGCATTAGG
Primer_r	: AGTGCTCTGTAAGGAATTGTG
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2911 bp
Genome contig ID	gi51511734r_24512792
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TACAGAGCACTTATTAAAAAAAAATCTTAAGAGTT
Flanking genome sequence (99980 - 99931)	----+--------+--------+--------+--------+----* GATCTGTTTTCTGATTATTTTGTGTAAGCTTCTAAACAAACTTCAGCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	24612772	24645262	4	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1321

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information