HUGE

Gene/Protein Characteristic Table for KIAA1318

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00801
Accession No. :	AB037739
Description :	Retrotransposon gag domain-containing protein 1.
HUGO Gene Name :	retrotransposon gag domain containing 1 (RGAG1)
Clone Name :	fh13683 [Vector Info]
Flexi ORF Clone :	pF1KSDA1318
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5425 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1012 bp

Genome contig ID gi89161218f_109475036
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTATAAAAGTAAATAAACTTCATTTATGAAAAAAG
Flanking genome sequence
(111183 - 111232)
----+----*----+----*----+----*----+----*----+----*
AGTTCATTGTGGCTCCTAGAATTTGATTTACTGAGTCCTTTATTCAACCA

Features of the protein sequence	Description

Length: 1418 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8NET4	0	100.0	Retrotransposon...	Homo sapiens
BAG63730	3.1e-170	68.4	unnamed protein...	Homo sapiens
EDL14737	4.7e-169	67.7	mCG7581 [Mus mu...	Mus musculus
XP_001474956	4.8e-169	67.7	similar to hypo...	Mus musculus
CAM26771	8.5e-158	67.0	retrotransposon...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005162 1273 1310 PF03732 Retrotransposon gag protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005162	1273	1310	PF03732	Retrotransposon gag protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCCTTGTAACCCAGTAGAC

Primer_r
: GTCAAGAGTTTAGCCCAATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACCCTTGTAACCCAGTAGAC
Primer_r	: GTCAAGAGTTTAGCCCAATGC
PCR product length	: 192 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1012 bp
Genome contig ID	gi89161218f_109475036
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTATAAAAGTAAATAAACTTCATTTATGAAAAAAG
Flanking genome sequence (111183 - 111232)	----+--------+--------+--------+--------+----* AGTTCATTGTGGCTCCTAGAATTTGATTTACTGAGTCCTTTATTCAACCA

Gene/Protein Characteristic Table for KIAA1318

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information