HUGE

Gene/Protein Characteristic Table for KIAA1294

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05232
Accession No. :	AB037715
Description :	FERM domain-containing protein 4A.
HUGO Gene Name :	FERM domain containing 4A (FRMD4A)
Clone Name :	fg01155 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6816 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3327 bp

Genome contig ID gi89161187r_13625718
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GTGTTGTCAACACTTATTAAAGCATTTTCAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAGATCCCAGCTGCCTCCTGGAGATTTTGTTCCTTTGTCTGTCAGCGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 13725718 14412889 25 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51245	100.0	FERM domain con...	Homo sapiens
Q9P2Q2	99.9	FERM domain-con...	Homo sapiens
EAW86275	99.9	FERM domain con...	Homo sapiens
XP_001143334	99.8	hypothetical pr...	Pan troglodytes
XP_507665	99.8	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023230	2.7e-86	48.8	KIAA1013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000299 65 77 PR00935 Band 4.1

IPR000299 145 165 PR00935 Band 4.1

IPR000299 213 229 PR00935 Band 4.1

HMMPfam IPR000299 34 233 PF00373 Band 4.1

HMMSmart IPR000299 28 233 SM00295 Band 4.1

ProfileScan IPR000299 32 334 PS50057 Band 4.1

ScanRegExp IPR000299 86 117 PS00660 Band 4.1

IPR000299 203 232 PS00661 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	65	77	PR00935	Band 4.1
IPR000299	145	165	PR00935	Band 4.1
IPR000299	213	229	PR00935	Band 4.1
HMMPfam	IPR000299	34	233	PF00373	Band 4.1
HMMSmart	IPR000299	28	233	SM00295	Band 4.1
ProfileScan	IPR000299	32	334	PS50057	Band 4.1
ScanRegExp	IPR000299	86	117	PS00660	Band 4.1
IPR000299	203	232	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTATGTAAACTGGTGTCCTC

Primer_r
: GCTAACAGTACCCTCTATGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3327 bp
Genome contig ID	gi89161187r_13625718
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTGTTGTCAACACTTATTAAAGCATTTTCAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAGATCCCAGCTGCCTCCTGGAGATTTTGTTCCTTTGTCTGTCAGCGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	13725718	14412889	25	99.4	Perfect prediction

Primer_f	: CCTATGTAAACTGGTGTCCTC
Primer_r	: GCTAACAGTACCCTCTATGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1294

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information