HUGE

Gene/Protein Characteristic Table for KIAA1013

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB023230
Description :	FERM domain-containing protein 4B.
HUGO Gene Name :	FERM domain containing 4B (FRMD4B)
Clone Name :	hj06791 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4779 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 1594 bp

Genome contig ID gi89161205r_69202109
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTACATAGGTCAATAAACAAAAGGTGTGCTACTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGTTTACGTTTTCTTCCATTTATGTCAGGGGTTCATGTGAAGCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 69302109 69517914 23 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1062 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516575	99.3	FERM domain con...	Pan troglodytes
XP_001086554	98.1	FERM domain con...	Macaca mulatta
NP_055938	99.9	FERM domain con...	Homo sapiens
XP_541808	95.1	similar to FERM...	Canis lupus fam...
XP_001916218	95.6	FERM domain con...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037715	1.8e-98	48.8	KIAA1294
AB002336	0.00014	22.2	KIAA0338

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000299 120 132 PR00935 Band 4.1

IPR000299 200 220 PR00935 Band 4.1

IPR000299 268 284 PR00935 Band 4.1

HMMPfam IPR000299 89 288 PF00373 Band 4.1

HMMSmart IPR000299 83 288 SM00295 Band 4.1

ProfileScan IPR000299 87 389 PS50057 Band 4.1

ScanRegExp IPR000299 258 287 PS00661 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000299	120	132	PR00935	Band 4.1
IPR000299	200	220	PR00935	Band 4.1
IPR000299	268	284	PR00935	Band 4.1
HMMPfam	IPR000299	89	288	PF00373	Band 4.1
HMMSmart	IPR000299	83	288	SM00295	Band 4.1
ProfileScan	IPR000299	87	389	PS50057	Band 4.1
ScanRegExp	IPR000299	258	287	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAACTTATGGTAGCAGATTGG

Primer_r
: CCACTTCAAATGACAGCCGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	1594 bp
Genome contig ID	gi89161205r_69202109
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTACATAGGTCAATAAACAAAAGGTGTGCTACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTTTACGTTTTCTTCCATTTATGTCAGGGGTTCATGTGAAGCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	69302109	69517914	23	99.4	Perfect prediction

Primer_f	: TAACTTATGGTAGCAGATTGG
Primer_r	: CCACTTCAAATGACAGCCGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1013

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information