HUGE

Gene/Protein Characteristic Table for KIAA1276

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00793
Accession No. :	AB033102
Description :
HUGO Gene Name :	family with sequence similarity 184, member B (FAM184B)
Clone Name :	fh00139s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1276
Source :	Human fetal brain
Note :	We replaced fh00139, former representative clones for KIAA1276 with fh00139s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3653 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 444 bp

Genome contig ID gi89161207r_17143095
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AACCAGCCTGGGTGACAGAGGGAGACCCTGTCTCC
Flanking genome sequence
(99714 - 99665)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTGACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 17242809 17392046 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1068 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULE4	99.7	Protein FAM184B.	Homo sapiens
NP_056503	99.6	hypothetical pr...	Homo sapiens
XP_001118953	93.7	similar to [Seg...	Macaca mulatta
XP_536227	84.6	similar to Myos...	Canis lupus fam...
XP_602183	82.7	similar to hCG4...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037740	1.6e-05	23.3	KIAA1319
AB023217	3.6e-05	22.0	KIAA1000
AB007914	0.0001	24.2	KIAA0445
D13629	0.00015	22.3	KIAA0004
AB046785	0.00016	22.4	KIAA1565

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTTCTGAGTGGCGATCTGAG

Primer_r
: TAGACTGGTTGGGTTTGTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTTTCTGAGTGGCGATCTGAG
Primer_r	: TAGACTGGTTGGGTTTGTAGG
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	444 bp
Genome contig ID	gi89161207r_17143095
PolyA signal sequence (None)	+--------+--------+----*----+---- AACCAGCCTGGGTGACAGAGGGAGACCCTGTCTCC
Flanking genome sequence (99714 - 99665)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTGACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	17242809	17392046	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1276

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information