HUGE

Gene/Protein Characteristic Table for KIAA1248

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00205
Accession No. :	AB033074
Description :	Protein NDRG2.
HUGO Gene Name :	NDRG family member 2 (NDRG2)
Clone Name :	hh03309a [Vector Info]
Flexi ORF Clone :	pF1KA1248
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 1932 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 823 bp

Genome contig ID gi51511730r_20454772
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACTTCTGCTATAACAATAAACTGTAGAGGAATCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTACCGTTATTATTCTTTGTCTAGGTGTGCCTGCATCATGCTCCTCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 20554772 20563704 15 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG56997	1.7e-149	99.7	unnamed protein...	Homo sapiens
AAD43131	1e-148	100.0	syld709613 prot...	Homo sapiens
CAH92721	1.8e-148	99.7	hypothetical pr...	Pongo abelii
CAH92501	4.6e-148	99.4	hypothetical pr...	Pongo abelii
AAH93038	5.3e-148	99.4	NDRG family mem...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033006	5e-79	62.3	KIAA1180

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004142 37 315 PF03096 Ndr

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004142	37	315	PF03096	Ndr

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGTGTGCATCTAGAGTGGG

Primer_r
: TAGCAGAAGTTGTGGGAGACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	823 bp
Genome contig ID	gi51511730r_20454772
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACTTCTGCTATAACAATAAACTGTAGAGGAATCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTACCGTTATTATTCTTTGTCTAGGTGTGCCTGCATCATGCTCCTCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	20554772	20563704	15	99.5	Perfect prediction

Primer_f	: TCAGTGTGCATCTAGAGTGGG
Primer_r	: TAGCAGAAGTTGTGGGAGACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1248

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information