HUGE

Gene/Protein Characteristic Table for KIAA1246

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00779
Accession No. :	AB033072
Description :	Leucine-rich repeat and fibronectin type-III domain-containing protein 2 precursor.
HUGO Gene Name :
Clone Name :	hh00149a [Vector Info]
Flexi ORF Clone :	pF1KSDA1246
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3144 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 309 bp

Genome contig ID gi89161210r_40367351
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTAGCCTACAAGCAAGCGGCTTTGGATTGCTTATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGTCTAGTGTTGTTTTTATTTCTTAATTTATTTTTTTTCCATTTCCCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 40467351 40663104 3 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULH4	100.0	Leucine-rich re...	Homo sapiens
Q9BE71	99.4	Leucine-rich re...	Macaca fascicularis
XP_001114127	95.0	similar to leuc...	Macaca mulatta
XP_538906	95.9	similar to leuc...	Canis lupus fam...
EDM18946	95.3	leucine rich re...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040917	8.2e-43	47.7	KIAA1484
AB007876	3.6e-06	35.2	KIAA0416
AB014544	4.8e-06	32.6	KIAA0644
AB020725	7e-05	26.6	KIAA0918
AB018349	0.00015	25.8	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 194 207 PR00019 Leucine-rich repeat

IPR001611 239 252 PR00019 Leucine-rich repeat

HMMPfam IPR001611 120 140 PF00560 Leucine-rich repeat

IPR001611 144 166 PF00560 Leucine-rich repeat

IPR001611 168 190 PF00560 Leucine-rich repeat

IPR001611 193 215 PF00560 Leucine-rich repeat

IPR001611 217 239 PF00560 Leucine-rich repeat

IPR001611 241 263 PF00560 Leucine-rich repeat

IPR013098 332 419 PF07679 Immunoglobulin I-set

IPR003961 461 536 PF00041 Fibronectin

HMMSmart IPR003591 118 141 SM00369 Leucine-rich repeat

IPR003591 142 165 SM00369 Leucine-rich repeat

IPR003591 166 189 SM00369 Leucine-rich repeat

IPR003591 191 214 SM00369 Leucine-rich repeat

IPR003591 215 238 SM00369 Leucine-rich repeat

IPR003591 239 263 SM00369 Leucine-rich repeat

IPR000483 285 330 SM00082 Cysteine-rich flanking region

IPR003599 338 420 SM00409 Immunoglobulin subtype

IPR003598 344 409 SM00408 Immunoglobulin subtype 2

ProfileScan IPR007110 332 418 PS50835 Immunoglobulin-like

IPR003961 461 553 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	194	207	PR00019	Leucine-rich repeat
IPR001611	239	252	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	120	140	PF00560	Leucine-rich repeat
IPR001611	144	166	PF00560	Leucine-rich repeat
IPR001611	168	190	PF00560	Leucine-rich repeat
IPR001611	193	215	PF00560	Leucine-rich repeat
IPR001611	217	239	PF00560	Leucine-rich repeat
IPR001611	241	263	PF00560	Leucine-rich repeat
IPR013098	332	419	PF07679	Immunoglobulin I-set
IPR003961	461	536	PF00041	Fibronectin
HMMSmart	IPR003591	118	141	SM00369	Leucine-rich repeat
IPR003591	142	165	SM00369	Leucine-rich repeat
IPR003591	166	189	SM00369	Leucine-rich repeat
IPR003591	191	214	SM00369	Leucine-rich repeat
IPR003591	215	238	SM00369	Leucine-rich repeat
IPR003591	239	263	SM00369	Leucine-rich repeat
IPR000483	285	330	SM00082	Cysteine-rich flanking region
IPR003599	338	420	SM00409	Immunoglobulin subtype
IPR003598	344	409	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	332	418	PS50835	Immunoglobulin-like
IPR003961	461	553	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 574 GGTMILVIGGIIVATLLVFIVIL 596 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	574	GGTMILVIGGIIVATLLVFIVIL	596	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAAAGAATCTCACTGGCAAG

Primer_r
: CCATTGACAGGGAGACGAAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGAAAGAATCTCACTGGCAAG
Primer_r	: CCATTGACAGGGAGACGAAAC
PCR product length	: 85 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	309 bp
Genome contig ID	gi89161210r_40367351
PolyA signal sequence (None)	+--------+--------+----*----+---- GTAGCCTACAAGCAAGCGGCTTTGGATTGCTTATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GGTCTAGTGTTGTTTTTATTTCTTAATTTATTTTTTTTCCATTTCCCAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	40467351	40663104	3	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1246

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information