| HUGE |
Gene/Protein Characteristic Table for KIAA1243 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06001 |
|---|---|
| Accession No. : | AB033069 |
| Description : | MKL/myocardin-like protein 2. |
| HUGO Gene Name : | |
| Clone Name : | pf00817 [Vector Info] |
| Source : | Human brain (hippocampus) |
| Note : | We replaced he00844, former representative clones for KIAA1243 with pf00817. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7815 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5328 bp Genome contig ID gi51511732f_14141593 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
CATTTTTGTGTCTCAAATAAAAGACATTTTGATGTFlanking genome sequence
(126539 - 126588) ----+----*----+----*----+----*----+----*----+----*
ACTATGATTCTTGCTGTGCAGAGGAAAGACCACTCCCTATGGGTTGGTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 14235624 14268130 9 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 828 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : ACAGAGCTTTATGCCAACTAC | |
| : TTCCTAAATGCTTCCTCTTCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : ACAGAGCTTTATGCCAACTAC | |
| : TTCCTAAATGCTTCCTCTTCC | |
| : 134 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |