HUGE

Gene/Protein Characteristic Table for KIAA1238

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00204
Accession No. :	AB033064
Description :	Ribosomal protein S6 modification-like protein B.
HUGO Gene Name :	ribosomal modification protein rimK-like family member B (RIMKLB)
Clone Name :	fh09938 [Vector Info]
Flexi ORF Clone :	pF1KA1238
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5393 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3407 bp

Genome contig ID gi89161190f_8643709
PolyA signal sequence
(AATATA,-25)
+----*----+----*----+----*----+----
TAAAAAATGTAATATATTGCAGGATTTATAACCAG
Flanking genome sequence
(177346 - 177395)
----+----*----+----*----+----*----+----*----+----*
GTTCACTGACTGCTTGCTTGCTTTCTTTTTTTTTTTTTTTTTTTTTTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 8743709 8821053 6 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 408 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001118430	7.5e-170	99.8	hypothetical pr...	Macaca mulatta
XP_543825	1e-163	98.7	hypothetical pr...	Canis lupus fam...
XP_001916098	2.1e-162	99.7	hypothetical pr...	Equus caballus
XP_001927870	3.9e-162	99.2	hypothetical pr...	Sus scrofa
Q0VCE9	7.3e-161	98.4	Ribosomal prote...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013651 134 325 PF08443 ATP-grasp fold

HMMTigr IPR004666 30 325 TIGR00768 S6 modification enzyme RimK

ProfileScan IPR011761 141 326 PS50975 ATP-grasp fold

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013651	134	325	PF08443	ATP-grasp fold
HMMTigr	IPR004666	30	325	TIGR00768	S6 modification enzyme RimK
ProfileScan	IPR011761	141	326	PS50975	ATP-grasp fold

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGTTATACTTTTCTCCTGGC

Primer_r
: GTTACCTGTCTGAGCACCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTGTTATACTTTTCTCCTGGC
Primer_r	: GTTACCTGTCTGAGCACCTAC
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3407 bp
Genome contig ID	gi89161190f_8643709
PolyA signal sequence (AATATA,-25)	+--------+--------+----*----+---- TAAAAAATGTAATATATTGCAGGATTTATAACCAG
Flanking genome sequence (177346 - 177395)	----+--------+--------+--------+--------+----* GTTCACTGACTGCTTGCTTGCTTTCTTTTTTTTTTTTTTTTTTTTTTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	8743709	8821053	6	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1238

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information