HUGE

Gene/Protein Characteristic Table for KIAA1236

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05753
Accession No. :	AB033062
Description :	kinesin family member 26A.
HUGO Gene Name :	kinesin family member 26A (KIF26A)
Clone Name :	pg00641 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced fh08822, former representative clones for KIAA1236 with pg00641. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6627 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1104 bp

Genome contig ID gi51511730f_103575217
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GCTTTTATTTGTGAATTAAAGATGCATCGATGGTT
Flanking genome sequence
(141769 - 141818)
----+----*----+----*----+----*----+----*----+----*
CCCACGGCTGCCGAGTTCACTGGGCGTCGGCAGACTCCTCACGCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 103675217 103716984 14 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1840 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06715	100.0	KIF26A variant ...	Homo sapiens
Q9ULI4	100.0	Kinesin-like pr...	Homo sapiens
EAW81861	100.0	hCG22909, isofo...	Homo sapiens
EAW81860	99.9	hCG22909, isofo...	Homo sapiens
Q52KG5	77.6	Kinesin-like pr...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26361	0.00079	29.7	KIAA0042

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001752 418 439 PR00380 Kinesin

IPR001752 587 605 PR00380 Kinesin

IPR001752 632 653 PR00380 Kinesin

HMMPfam IPR001752 335 684 PF00225 Kinesin

HMMSmart IPR001752 327 691 SM00129 Kinesin

ProfileScan IPR001752 326 608 PS50067 Kinesin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	418	439	PR00380	Kinesin
IPR001752	587	605	PR00380	Kinesin
IPR001752	632	653	PR00380	Kinesin
HMMPfam	IPR001752	335	684	PF00225	Kinesin
HMMSmart	IPR001752	327	691	SM00129	Kinesin
ProfileScan	IPR001752	326	608	PS50067	Kinesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGCCGTGGGAATTTGAAGAC

Primer_r
: AAGTATGAGCCTGTCGTGCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGCCGTGGGAATTTGAAGAC
Primer_r	: AAGTATGAGCCTGTCGTGCGG
PCR product length	: 216 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1104 bp
Genome contig ID	gi51511730f_103575217
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GCTTTTATTTGTGAATTAAAGATGCATCGATGGTT
Flanking genome sequence (141769 - 141818)	----+--------+--------+--------+--------+----* CCCACGGCTGCCGAGTTCACTGGGCGTCGGCAGACTCCTCACGCCCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	103675217	103716984	14	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1236

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information