HUGE

Gene/Protein Characteristic Table for KIAA1234

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00775
Accession No. :	AB033060
Description :	aryl-hydrocarbon receptor repressor.
HUGO Gene Name :	aryl-hydrocarbon receptor repressor (AHRR)
Clone Name :	fh08618 [Vector Info]
Flexi ORF Clone :	pF1KSDA1234
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3521 bp

Genome contig ID gi51511721f_257291
PolyA signal sequence
(AATACA,-29)
+----*----+----*----+----*----+----
ATGTAAAATACATGACATGCTAGTACATGTTTAAC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 357289 499796 14 99.1 Both No-hit

Features of the protein sequence	Description

Length: 727 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW50992	100.0	hCG2044128 [Hom...	Homo sapiens
AAI60162	99.9	Aryl-hydrocarbo...	synthetic construct
EAW50995	100.0	hCG1985585, iso...	Homo sapiens
AAG33381	99.9	dioxin receptor...	Homo sapiens
EAW50998	100.0	hCG1985585, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001092 46 90 PF00010 Basic helix-loop-helix dimerisation region bHLH

IPR013767 122 187 PF00989 PAS fold

HMMSmart IPR001092 43 97 SM00353 Basic helix-loop-helix dimerisation region bHLH

IPR000014 122 188 SM00091 PAS

ProfileScan IPR001092 25 90 PS50888 Basic helix-loop-helix dimerisation region bHLH

IPR000014 125 190 PS50112 PAS

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	46	90	PF00010	Basic helix-loop-helix dimerisation region bHLH
IPR013767	122	187	PF00989	PAS fold
HMMSmart	IPR001092	43	97	SM00353	Basic helix-loop-helix dimerisation region bHLH
IPR000014	122	188	SM00091	PAS
ProfileScan	IPR001092	25	90	PS50888	Basic helix-loop-helix dimerisation region bHLH
IPR000014	125	190	PS50112	PAS

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGATTGAGTGGTGGGTTGCT

Primer_r
: GGGAGTTTTTGTTGCCGTTGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGATTGAGTGGTGGGTTGCT
Primer_r	: GGGAGTTTTTGTTGCCGTTGA
PCR product length	: 177 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3521 bp
Genome contig ID	gi51511721f_257291
PolyA signal sequence (AATACA,-29)	+--------+--------+----*----+---- ATGTAAAATACATGACATGCTAGTACATGTTTAAC
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	357289	499796	14	99.1	Both No-hit

Gene/Protein Characteristic Table for KIAA1234

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information