| HUGE |
Gene/Protein Characteristic Table for KIAA1222 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06461 |
|---|---|
| Accession No. : | AB033048 |
| Description : | Neurabin-1. |
| HUGO Gene Name : | protein phosphatase 1, regulatory (inhibitor) subunit 9A (PPP1R9A) |
| Clone Name : | fh03567 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5357 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3126 bp Genome contig ID gi89161213f_94278428 PolyA signal sequence
(AATAAA,-30) +----*----+----*----+----*----+----
ATGACAATAAAGCTGTTCTGTGGCTATCATCCTTTFlanking genome sequence
(482251 - 482300) ----+----*----+----*----+----*----+----*----+----*
AGCTGGGATTGACAATTGATTTCACACCCTCAACATCACAAGCTTTTTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 f 94378428 94760677 15 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 742 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGCTAGTGGTTTTCAGTGTCC | |
| : TCCCTCCCAACAAAGCATAAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 7 |
| : GeneBridge 4 | |
| : TGCTAGTGGTTTTCAGTGTCC | |
| : TCCCTCCCAACAAAGCATAAC | |
| : 202 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |