| HUGE |
Gene/Protein Characteristic Table for KIAA1219 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01627 |
|---|---|
| Accession No. : | AB033045 |
| Description : | K1219_HUMAN Isoform 4 of Q86X10 - Homo sapiens. |
| HUGO Gene Name : | |
| Clone Name : | ef03859 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1219
![]() |
| Source : | |
| Note : | We replaced fh03044 and bg00043, former representative clones for KIAA1219 with ef03859. (2002/5/10,2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 8654 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3894 bp Genome contig ID gi51511747f_36434873 PolyA signal sequence
(ATTAAA,-29) +----*----+----*----+----*----+----
TAGTCAATTAAATTTTAAGGAGATTCTTATCTAATFlanking genome sequence
(206045 - 206094) ----+----*----+----*----+----*----+----*----+----*
AACTTTGTGTGTGCTTTTGGATACAGGCTGAGGCTTTACTCCTACACTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 36534873 36640916 30 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1534 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |