HUGE |
Gene/Protein Characteristic Table for KIAA1209 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06396 |
---|---|
Accession No. : | AB033035 |
Description : | Pleckstrin homology domain-containing family G member 1. |
HUGO Gene Name : | pleckstrin homology domain containing, family G (with RhoGef domain) member 1 (PLEKHG1) |
Clone Name : | fg05970 [Vector Info] |
Flexi ORF Clone : | pF1KA1209
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6110 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2767 bp Genome contig ID gi89161210f_151067474 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GTCCATTATTTAATAAAGTTTGTAAAGTACAAGGTFlanking genome sequence
(139020 - 139069) ----+----*----+----*----+----*----+----*----+----*
AATTTATAGTGTGAATTAATGTGTTTATTTTAGAACATCAAGATGTTTCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 151167474 151206492 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1113 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 52 | 144 | PF00169 | Pleckstrin-like |
HMMSmart | IPR001849 | 52 | 146 | SM00233 | Pleckstrin-like |
ProfileScan | IPR001849 | 45 | 144 | PS50003 | Pleckstrin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTATCACAGGTCCCAGTCATC | |
: TTCTGTGAGTCTTGGAGTGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |