| HUGE |
Gene/Protein Characteristic Table for KIAA1207 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01681 |
|---|---|
| Accession No. : | AB033033 |
| Description : | Myoferlin. |
| HUGO Gene Name : | myoferlin (MYOF) |
| Clone Name : | fg04512s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1207
|
| Source : | Human fetal brain |
| Note : | We replaced fg04512, former representative clones for KIAA1207 with fg04512s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6719 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 533 bp Genome contig ID gi89161187r_94956177 PolyA signal sequence
(AATAAA,-20)
TCTGTAATGAAACTAAATAAAAATGTTTCACCTTTFlanking genome sequence
(100000 - 99951)
ACACCTGGCTGTTTGTTGTAACTGTGGGTCAAGTGAGGAAGGAGGCATTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 95056177 95231941 53 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2061 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : GGACGAACCCAACATGAACCC | |
| : GACAAATAGTTCGGCAAAGAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 10 |
| : GeneBridge 4 | |
| : TTCCCAGACCCCTATGATGAG | |
| : TATTTCTCAACAACCAGCAGG | |
| : 158(1.3k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
