HUGE |
Gene/Protein Characteristic Table for KIAA1196 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07484 |
---|---|
Accession No. : | AB033022 |
Description : | Zinc finger protein 512B. |
HUGO Gene Name : | |
Clone Name : | fg01776 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5742 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3185 bp Genome contig ID gi51511747r_61958511 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GACTGTATCAAATAAATGTTTATTGATTTTTTTCCFlanking genome sequence
(99991 - 99942) ----+----*----+----*----+----*----+----*----+----*
AGGGTTTTTGTGCGGCTCAGTTTGTGGTGAAAAACAGGGGGCGGGGCCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 62058502 62069319 15 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 851 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR004829 | 130 | 185 | PD153432 | Cell surface antigen |
HMMPfam | IPR007087 | 99 | 122 | PF00096 | Zinc finger |
IPR007087 | 499 | 522 | PF00096 | Zinc finger | |
IPR007087 | 589 | 612 | PF00096 | Zinc finger | |
IPR007087 | 743 | 766 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 64 | 86 | SM00355 | Zinc finger |
IPR015880 | 99 | 122 | SM00355 | Zinc finger | |
IPR015880 | 499 | 522 | SM00355 | Zinc finger | |
IPR015880 | 553 | 575 | SM00355 | Zinc finger | |
IPR015880 | 589 | 612 | SM00355 | Zinc finger | |
IPR015880 | 743 | 766 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 99 | 126 | PS50157 | Zinc finger |
IPR007087 | 499 | 527 | PS50157 | Zinc finger | |
IPR007087 | 589 | 617 | PS50157 | Zinc finger | |
IPR007087 | 743 | 767 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 101 | 122 | PS00028 | Zinc finger |
IPR007087 | 501 | 522 | PS00028 | Zinc finger | |
IPR007087 | 591 | 612 | PS00028 | Zinc finger | |
IPR007087 | 745 | 766 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGTGAGAGGGACCAGCATAGC | |
: AGTGCATCCCATTTTCGTGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: AGTGAGAGGGACCAGCATAGC | |
: AGTGCATCCCATTTTCGTGTG | |
: 184 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |