HUGE |
Gene/Protein Characteristic Table for KIAA1190 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07401 |
---|---|
Accession No. : | AB033016 |
Description : | zinc finger and BTB domain containing 47 (ZBTB47), mRNA. |
HUGO Gene Name : | zinc finger and BTB domain containing 47 (ZBTB47) |
Clone Name : | hg03443a [Vector Info] |
Flexi ORF Clone : | pF1KA1190
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3510 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2983 bp Genome contig ID gi89161205f_42580291 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
GAGGATGAAGGGGAATAAAGTCAGTACAACTCGTGFlanking genome sequence
(103787 - 103836) ----+----*----+----*----+----*----+----*----+----*
TCCCTTGGCCCAGCCTCTTCTTTGCACTTGGCCTGCCTTGACTCTTGGAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 42679604 42684076 3 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 174 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 59 | 82 | PD000003 | Zinc finger |
HMMPfam | IPR007087 | 3 | 25 | PF00096 | Zinc finger |
IPR007087 | 31 | 53 | PF00096 | Zinc finger | |
IPR007087 | 59 | 81 | PF00096 | Zinc finger | |
IPR007087 | 87 | 109 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 3 | 25 | SM00355 | Zinc finger |
IPR015880 | 31 | 53 | SM00355 | Zinc finger | |
IPR015880 | 59 | 81 | SM00355 | Zinc finger | |
IPR015880 | 87 | 114 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 3 | 30 | PS50157 | Zinc finger |
IPR007087 | 31 | 58 | PS50157 | Zinc finger | |
IPR007087 | 59 | 86 | PS50157 | Zinc finger | |
IPR007087 | 87 | 115 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 5 | 25 | PS00028 | Zinc finger |
IPR007087 | 33 | 53 | PS00028 | Zinc finger | |
IPR007087 | 61 | 81 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AAAGTTGATCTCTCCCAGTGG | |
: AGGACAGGGTTTCATTGCCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |