HUGE

Gene/Protein Characteristic Table for KIAA1189

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00196
Accession No. :	AB033015
Description :
HUGO Gene Name :
Clone Name :	hg03032a [Vector Info]
Flexi ORF Clone :	pF1KA1189
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3535 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2632 bp

Genome contig ID gi89161199r_157783397
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
CCACAATTTAAATAAAGAACTGCTGTGTCTGACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCTCAATAAAAGTTTGTGTCTTTATTTCTGGTCTCTAGACTTTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 157883397 157890448 3 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 300 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG59118	3.4e-104	99.7	unnamed protein...	Homo sapiens
XP_515843	2.5e-103	98.6	hypothetical pr...	Pan troglodytes
Q5R6D6	2.4e-97	97.5	Ermin; Juxtanod...	Pongo abelii
XP_001087905	1.2e-92	93.3	hypothetical pr...	Macaca mulatta
XP_849476	1.7e-75	77.5	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011259 274 297 PF00769 Ezrin/radixin/moesin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011259	274	297	PF00769	Ezrin/radixin/moesin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAGAACTAGAGGTGGGTGAC

Primer_r
: GCACAGAGCTAAGAGGACCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTAGAACTAGAGGTGGGTGAC
Primer_r	: GCACAGAGCTAAGAGGACCAG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2632 bp
Genome contig ID	gi89161199r_157783397
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CCACAATTTAAATAAAGAACTGCTGTGTCTGACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTCAATAAAAGTTTGTGTCTTTATTTCTGGTCTCTAGACTTTATTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	157883397	157890448	3	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1189

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information