HUGE

Gene/Protein Characteristic Table for KIAA1184

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00756
Accession No. :	AB033010
Description :	myofibrillogenesis regulator 1 isoform 1.
HUGO Gene Name :	paroxysmal nonkinesigenic dyskinesia (PNKD)
Clone Name :	hg01696a [Vector Info]
Flexi ORF Clone :	pF1KSDA1184
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2951 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N490	9.2e-168	100.0	Probable hydrol...	Homo sapiens
BAE89909	5.1e-167	99.7	unnamed protein...	Macaca fascicularis
AAH36457	3.9e-166	99.2	Paroxysmal nonk...	Homo sapiens
Q69ZP3	4.4e-160	96.1	Probable hydrol...	Mus musculus
NP_001128222	5.9e-160	95.8	myofibrillogene...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001279 124 286 PF00753 Beta-lactamase-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001279	124	286	PF00753	Beta-lactamase-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACGTACAGGTTGGAAATCAG

Primer_r
: CTGGCTGACTCAAGGTACACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: GACGTACAGGTTGGAAATCAG
Primer_r	: CTGGCTGACTCAAGGTACACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1184

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information