HUGE

Gene/Protein Characteristic Table for KIAA1182

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06131
Accession No. :	AB033008
Description :	Negative elongation factor B.
HUGO Gene Name :	cofactor of BRCA1 (COBRA1)
Clone Name :	hg01322a [Vector Info]
Flexi ORF Clone :	pF1KA1182
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 1246 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 611 bp

Genome contig ID gi89161216f_139181230
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AGATTTTCTCGTATGTAAATAAAAGGCAATTTGGT
Flanking genome sequence
(106584 - 106633)
----+----*----+----*----+----*----+----*----+----*
AAACGTGGAGGCTGAGATGTCTCTGTGCCTGCCCTGAGGTTGGATGTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 139281230 139287812 5 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW88377	3e-82	100.0	cofactor of BRC...	Homo sapiens
EAW88378	3.1e-82	100.0	cofactor of BRC...	Homo sapiens
CAB43381	4e-82	100.0	hypothetical pr...	Homo sapiens
BAB14157	4.6e-82	100.0	unnamed protein...	Homo sapiens
AAH11892	4.6e-82	100.0	COBRA1 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010405 1 210 PF06209 Cofactor of BRCA1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010405	1	210	PF06209	Cofactor of BRCA1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTCTCCTTGTACTTTGGCAG

Primer_r
: CACAACCCCAAGGCAGTAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTCTCCTTGTACTTTGGCAG
Primer_r	: CACAACCCCAAGGCAGTAAGC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	611 bp
Genome contig ID	gi89161216f_139181230
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGATTTTCTCGTATGTAAATAAAAGGCAATTTGGT
Flanking genome sequence (106584 - 106633)	----+--------+--------+--------+--------+----* AAACGTGGAGGCTGAGATGTCTCTGTGCCTGCCCTGAGGTTGGATGTAGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	139281230	139287812	5	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1182

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information