HUGE

Gene/Protein Characteristic Table for KIAA1177

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07375
Accession No. :	AB033003
Description :	XPA-binding protein 2.
HUGO Gene Name :
Clone Name :	hf00837a [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2330 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 60 bp

Genome contig ID gi42406306r_7490472
PolyA signal sequence
(AATACA,-22)
+----*----+----*----+----*----+----
CCACCCCCTCCCCAATACAGCTACGTTTGTACATC
Flanking genome sequence
(99940 - 99891)
----+----*----+----*----+----*----+----*----+----*
ATGGTCTGAGCCTCCTTCCTGCTGCCCAGGTGCCCGAGGGAGTACAGCTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 7590412 7598639 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 755 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCS7	100.0	Pre-mRNA-splici...	Homo sapiens
BAB15807	99.9	XAB2 [Homo sapi...	Homo sapiens
AAQ14304	99.9	crn-related pro...	Homo sapiens
Q99PK0	99.1	Pre-mRNA-splici...	Rattus norvegicus
Q9DCD2	99.1	Pre-mRNA-splici...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013105 156 189 PF07719 Tetratricopeptide TPR_2

HMMSmart IPR003107 24 58 SM00386 RNA-processing protein

IPR013026 156 189 SM00028 Tetratricopeptide region

IPR003107 170 205 SM00386 RNA-processing protein

IPR013026 295 328 SM00028 Tetratricopeptide region

IPR003107 309 345 SM00386 RNA-processing protein

IPR013026 333 366 SM00028 Tetratricopeptide region

IPR003107 347 396 SM00386 RNA-processing protein

IPR003107 398 430 SM00386 RNA-processing protein

IPR003107 432 466 SM00386 RNA-processing protein

IPR003107 471 505 SM00386 RNA-processing protein

IPR003107 507 541 SM00386 RNA-processing protein

IPR003107 579 613 SM00386 RNA-processing protein

ProfileScan IPR013026 10 43 PS50005 Tetratricopeptide region

IPR013026 156 189 PS50005 Tetratricopeptide region

IPR013026 156 189 PS50293 Tetratricopeptide region

IPR013026 295 328 PS50005 Tetratricopeptide region

IPR013026 295 366 PS50293 Tetratricopeptide region

IPR013026 333 366 PS50005 Tetratricopeptide region

IPR013026 384 451 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	156	189	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR003107	24	58	SM00386	RNA-processing protein
IPR013026	156	189	SM00028	Tetratricopeptide region
IPR003107	170	205	SM00386	RNA-processing protein
IPR013026	295	328	SM00028	Tetratricopeptide region
IPR003107	309	345	SM00386	RNA-processing protein
IPR013026	333	366	SM00028	Tetratricopeptide region
IPR003107	347	396	SM00386	RNA-processing protein
IPR003107	398	430	SM00386	RNA-processing protein
IPR003107	432	466	SM00386	RNA-processing protein
IPR003107	471	505	SM00386	RNA-processing protein
IPR003107	507	541	SM00386	RNA-processing protein
IPR003107	579	613	SM00386	RNA-processing protein
ProfileScan	IPR013026	10	43	PS50005	Tetratricopeptide region
IPR013026	156	189	PS50005	Tetratricopeptide region
IPR013026	156	189	PS50293	Tetratricopeptide region
IPR013026	295	328	PS50005	Tetratricopeptide region
IPR013026	295	366	PS50293	Tetratricopeptide region
IPR013026	333	366	PS50005	Tetratricopeptide region
IPR013026	384	451	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCAAGATCCTGTTCGTGAG

Primer_r
: GTCAGTCTTCCTTCAGGCTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGCAAGATCCTGTTCGTGAG
Primer_r	: GTCAGTCTTCCTTCAGGCTCC
PCR product length	: 194 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	60 bp
Genome contig ID	gi42406306r_7490472
PolyA signal sequence (AATACA,-22)	+--------+--------+----*----+---- CCACCCCCTCCCCAATACAGCTACGTTTGTACATC
Flanking genome sequence (99940 - 99891)	----+--------+--------+--------+--------+----* ATGGTCTGAGCCTCCTTCCTGCTGCCCAGGTGCCCGAGGGAGTACAGCTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	7590412	7598639	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1177

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information