HUGE

Gene/Protein Characteristic Table for KIAA1172

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB032998
Description :	Splicing factor, arginine/serine-rich 15.
HUGO Gene Name :	splicing factor, arginine/serine-rich 15 (SFRS15)
Clone Name :	hj03919 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4719 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 363 bp

Genome contig ID gi51511750r_31865220
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATAGGGATGTTTTTAATAAACTCTATTTTCGTAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTTAATGTGTGCTATTCTTCCTACACTGCATTAAGGTGGAAAAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 21 r 31965220 31995357 14 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 929 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX09887	0	99.9	splicing factor...	Homo sapiens
CAD38974	0	99.9	hypothetical pr...	Homo sapiens
XP_001097429	2.6e-215	97.3	similar to spli...	Macaca mulatta
AAH53096	7.4e-163	81.6	Sfrs15 protein ...	Mus musculus
EDK98387	7.4e-163	81.6	mCG129573, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029039	1.2e-20	37.0	KIAA1116
AB007927	0.00035	23.5	KIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan NULL 457 469 PR01217 NULL

NULL 471 487 PR01217 NULL

NULL 499 511 PR01217 NULL

NULL 519 540 PR01217 NULL

NULL 547 563 PR01217 NULL

HMMPfam IPR000504 314 381 PF00076 RNA recognition motif

HMMSmart IPR000504 313 382 SM00360 RNA recognition motif

ProfileScan IPR000504 312 386 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	457	469	PR01217	NULL
NULL	471	487	PR01217	NULL
NULL	499	511	PR01217	NULL
NULL	519	540	PR01217	NULL
NULL	547	563	PR01217	NULL
HMMPfam	IPR000504	314	381	PF00076	RNA recognition motif
HMMSmart	IPR000504	313	382	SM00360	RNA recognition motif
ProfileScan	IPR000504	312	386	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGACACACTTAACCCAGATTG

Primer_r
: TAGGTGCAGGAACAGGAATAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 21

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTGGGCATCGAGACAGAGAG
Primer_r	: GGCTAATGGGAGGTTCAACGG
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	363 bp
Genome contig ID	gi51511750r_31865220
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATAGGGATGTTTTTAATAAACTCTATTTTCGTAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTTAATGTGTGCTATTCTTCCTACACTGCATTAAGGTGGAAAAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	21	r	31965220	31995357	14	99.9	Terminal No-hit

Primer_f	: TGACACACTTAACCCAGATTG
Primer_r	: TAGGTGCAGGAACAGGAATAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1172

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information