| HUGE |
Gene/Protein Characteristic Table for KIAA1164 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK04977 |
|---|---|
| Accession No. : | AB032990 |
| Description : | family with sequence similarity 63, member B (FAM63B), transcript variant 1, mRNA. |
| HUGO Gene Name : | family with sequence similarity 63, member B (FAM63B) |
| Clone Name : | hk00541 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4097 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2923 bp Genome contig ID gi51511731f_56751576 PolyA signal sequence
(AATAGA,-21) +----*----+----*----+----*----+----
ATGCAAGCCTGGGCAATAGAGCGAGACTCCGTCTCFlanking genome sequence
(185450 - 185499) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAATTAGAGCTATTGTGTCTTTATTTTCTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 56851576 56937024 9 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 390 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : ACAATCTGGGAATAGTGAACG | |
| : TTAGGAAATCAGGCACAGACG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 15 |
| : GeneBridge 4 | |
| : ACAATCTGGGAATAGTGAACG | |
| : TTAGGAAATCAGGCACAGACG | |
| : 194 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |