HUGE

Gene/Protein Characteristic Table for KIAA1159

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06216
Accession No. :	AB032985
Description :	Neurexophilin-3 precursor.
HUGO Gene Name :
Clone Name :	hj00357 [Vector Info]
Flexi ORF Clone :	pF1KA1159
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5194 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4527 bp

Genome contig ID gi51511734f_44910995
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AATGAGTTGCTCAATAAATGTTACTTCCTCCTGTC
Flanking genome sequence
(105195 - 105244)
----+----*----+----*----+----*----+----*----+----*
TTTTTTTTTCTAAGATGGGTTGTTGTTAACCTTGGCCTTGCTCCTGGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 45010995 45016188 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O95157	1.4e-91	100.0	Neurexophilin-3...	Homo sapiens
AAH22541	5.1e-91	99.5	Neurexophilin 3...	Homo sapiens
XP_001093691	2.2e-90	98.2	similar to Neur...	Macaca mulatta
XP_851450	3.6e-89	97.3	similar to Neur...	Canis lupus fam...
XP_001502469	4.7e-88	95.9	similar to Neur...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010450 1 221 PF06312 Neurexophilin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010450	1	221	PF06312	Neurexophilin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCAAAGATTCCGAGTCCTG

Primer_r
: AGGTCTCTGCTGGCATTTGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCAAAGATTCCGAGTCCTG
Primer_r	: AGGTCTCTGCTGGCATTTGTG
PCR product length	: 186 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4527 bp
Genome contig ID	gi51511734f_44910995
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATGAGTTGCTCAATAAATGTTACTTCCTCCTGTC
Flanking genome sequence (105195 - 105244)	----+--------+--------+--------+--------+----* TTTTTTTTTCTAAGATGGGTTGTTGTTAACCTTGGCCTTGCTCCTGGTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	45010995	45016188	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1159

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information