| HUGE |
Gene/Protein Characteristic Table for KIAA1155 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00751 |
|---|---|
| Accession No. : | AB032981 |
| Description : | poly(A) binding protein interacting protein 2B. |
| HUGO Gene Name : | poly(A) binding protein interacting protein 2B (PAIP2B) |
| Clone Name : | hh04176 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1155
![]() |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6286 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5747 bp Genome contig ID gi89161199r_71063814 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GCAGCTGTTGAGAATCTCAATAAAATGTTAAATGCFlanking genome sequence
(199563 - 199514) ----+----*----+----*----+----*----+----*----+----*
ATTTGCTGGCAGTGGTACCCTTTTGCCTAAGGTTGGGTCACTGTGTTATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 71263377 71307721 4 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 145 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CAGGGGTAAGTGTCCGAAGTC | |
| : CAGCTCTTGAGGATGTTGTGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |