HUGE

Gene/Protein Characteristic Table for KIAA1155

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00751
Accession No. :	AB032981
Description :	poly(A) binding protein interacting protein 2B.
HUGO Gene Name :	poly(A) binding protein interacting protein 2B (PAIP2B)
Clone Name :	hh04176 [Vector Info]
Flexi ORF Clone :	pF1KSDA1155
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6286 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5747 bp

Genome contig ID gi89161199r_71063814
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCAGCTGTTGAGAATCTCAATAAAATGTTAAATGC
Flanking genome sequence
(199563 - 199514)
----+----*----+----*----+----*----+----*----+----*
ATTTGCTGGCAGTGGTACCCTTTTGCCTAAGGTTGGGTCACTGTGTTATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 71263377 71307721 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 145 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100423	1.7e-56	99.3	similar to Poly...	Macaca mulatta
XP_533009	5.3e-52	91.0	similar to Poly...	Canis lupus fam...
EAW99774	1.4e-48	99.2	hCG1988939, iso...	Homo sapiens
Q9ULR5	1e-47	100.0	Polyadenylate-b...	Homo sapiens
EDL91170	1.3e-42	88.7	similar to hypo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009818 127 144 PF07145 Ataxin-2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009818	127	144	PF07145	Ataxin-2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGGGTAAGTGTCCGAAGTC

Primer_r
: CAGCTCTTGAGGATGTTGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5747 bp
Genome contig ID	gi89161199r_71063814
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCAGCTGTTGAGAATCTCAATAAAATGTTAAATGC
Flanking genome sequence (199563 - 199514)	----+--------+--------+--------+--------+----* ATTTGCTGGCAGTGGTACCCTTTTGCCTAAGGTTGGGTCACTGTGTTATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	71263377	71307721	4	99.0	Perfect prediction

Primer_f	: CAGGGGTAAGTGTCCGAAGTC
Primer_r	: CAGCTCTTGAGGATGTTGTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1155

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information