HUGE

Gene/Protein Characteristic Table for KIAA1146

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04186
Accession No. :	AB032972
Description :	Ankyrin repeat and SOCS box protein 1.
HUGO Gene Name :
Clone Name :	hg00368 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6518 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5702 bp

Genome contig ID gi89161199f_238909092
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
CGAATTAAATAAAGACATGCATCCATCTGTCAGCG
Flanking genome sequence
(116539 - 116588)
----+----*----+----*----+----*----+----*----+----*
ACTCCTTGTGTGTTCTGCCTCTTCATTCCTTGTCCCGGAACCTCTGCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 239009092 239025629 4 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 271 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y576	5.6e-122	100.0	Ankyrin repeat ...	Homo sapiens
XP_516189	7.4e-122	100.0	ankyrin repeat ...	Pan troglodytes
XP_001087304	4.6e-121	98.9	ankyrin repeat ...	Macaca mulatta
XP_874696	5.1e-117	96.3	similar to anky...	Bos taurus
XP_001496957	9.5e-117	95.9	similar to anky...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033049	2.6e-09	29.0	KIAA1223
AB007856	2.6e-08	36.0	KIAA0396
AB046856	7.9e-08	30.2	KIAA1636
AB014597	1.1e-07	37.2	KIAA0697
AB051515	1.8e-07	34.9	KIAA1728

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 14 26 PR01415 Ankyrin

IPR002110 59 71 PR01415 Ankyrin

HMMPfam IPR002110 15 45 PF00023 Ankyrin

IPR002110 46 74 PF00023 Ankyrin

IPR002110 79 111 PF00023 Ankyrin

IPR002110 131 159 PF00023 Ankyrin

IPR002110 176 204 PF00023 Ankyrin

IPR001496 232 271 PF07525 SOCS protein

HMMSmart IPR002110 13 42 SM00248 Ankyrin

IPR002110 46 75 SM00248 Ankyrin

IPR002110 79 108 SM00248 Ankyrin

IPR002110 131 156 SM00248 Ankyrin

ProfileScan IPR002110 16 45 PS50088 Ankyrin

IPR002110 16 159 PS50297 Ankyrin

IPR002110 46 78 PS50088 Ankyrin

IPR002110 79 111 PS50088 Ankyrin

IPR001496 229 271 PS50225 SOCS protein

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	14	26	PR01415	Ankyrin
IPR002110	59	71	PR01415	Ankyrin
HMMPfam	IPR002110	15	45	PF00023	Ankyrin
IPR002110	46	74	PF00023	Ankyrin
IPR002110	79	111	PF00023	Ankyrin
IPR002110	131	159	PF00023	Ankyrin
IPR002110	176	204	PF00023	Ankyrin
IPR001496	232	271	PF07525	SOCS protein
HMMSmart	IPR002110	13	42	SM00248	Ankyrin
IPR002110	46	75	SM00248	Ankyrin
IPR002110	79	108	SM00248	Ankyrin
IPR002110	131	156	SM00248	Ankyrin
ProfileScan	IPR002110	16	45	PS50088	Ankyrin
IPR002110	16	159	PS50297	Ankyrin
IPR002110	46	78	PS50088	Ankyrin
IPR002110	79	111	PS50088	Ankyrin
IPR001496	229	271	PS50225	SOCS protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCATTCCAGGTTCATCCCAC

Primer_r
: TGATGGAGACTGTGGGCAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGATGGAGACTGTGGGCAAGC
Primer_r	: TTCATTCCAGGTTCATCCCAC
PCR product length	: 110 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5702 bp
Genome contig ID	gi89161199f_238909092
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- CGAATTAAATAAAGACATGCATCCATCTGTCAGCG
Flanking genome sequence (116539 - 116588)	----+--------+--------+--------+--------+----* ACTCCTTGTGTGTTCTGCCTCTTCATTCCTTGTCCCGGAACCTCTGCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	239009092	239025629	4	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA1146

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information